Recombinant protein HF2 used for methicillin-resistant staphylococcus aureus (MRSA) vaccine, and preparation method and application thereof

A recombinant protein, staphylococcus technology, applied in the biological field, can solve the problems of few treatment methods, difficult to control the situation, etc., and achieve the effects of easy separation and purification, simple steps, and high humoral immune response

Active Publication Date: 2014-03-12
CHENGDU OLYMVAX BIOPHARM +1
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

And as the multi-antibiotic resistance of the bacteria makes the situation more difficult to control, the options for treatment are fewer and fewer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant protein HF2 used for methicillin-resistant staphylococcus aureus (MRSA) vaccine, and preparation method and application thereof
  • Recombinant protein HF2 used for methicillin-resistant staphylococcus aureus (MRSA) vaccine, and preparation method and application thereof
  • Recombinant protein HF2 used for methicillin-resistant staphylococcus aureus (MRSA) vaccine, and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Example 1: The DNA sequence of methicillin-resistant Staphylococcus aureus Hla (H35L delta110-150) was synthesized by Shanghai Jierui Biotechnology Co., Ltd.

Embodiment 2

[0055] Example 2: PCR method was used to amplify the H portion used to construct HF2.

[0056] 1. Considering the connecting peptide SEQ ID NO:3 of the H segment, design the following primers to clone the H gene from the synthetic DNA sequence:

[0057] SEQ ID NO: 7gc ggatcc at ggcagattct gatattaataataa (underlined restriction restriction site BamHI)

[0058] SEQ ID NO:8aactaagctgccaccgccac catttgtcat ttc

[0059] 2. PCR clone gene

[0060] PCR system:

[0061] Template (100ng / μl)

0.5μl

SEQ ID NO: 7 (50 μM)

1μl

SEQ ID NO:8 (50μM)

1μl

Primerstar Taq Enzyme

0.5μl

dNTP

4μl

5X Buffer

10μl

Sterilized double distilled water

33μl

total capacity

50μl

[0062] The PCR amplification reaction conditions were denaturation at 98°C for 10s, annealing at 60°C for 10s, extension at 72°C for 1min and 30s, 30 cycles, and complete extension at 72°C for 6min. After the reaction was completed, ...

Embodiment 3

[0064] Example 3: Cloning of Methicillin-resistant Staphylococcus aureus Fibronectin Binding Protein A Active Fragment FNBA2 Active Fragment (F2)

[0065] 1. First, according to the full-length gene sequence of MRSA-252FnBA protein, use bioinformatics software for structural analysis to determine the FnBA1 target gene fragment that needs to be amplified.

[0066] 2. According to the analysis results, the PCR method was used to amplify the FnBA1 target gene fragment from the MRSA-252 genome, and the amplification steps were as follows:

[0067] 1) Design PCR primers as follows, respectively SEQ ID NO: 9-10

[0068] SEQ ID NO: 9ggtggcggtg gcagcttagt ttatatagt aataaagc

[0069] SEQ ID NO:10ttttcctttt gcggccgc ct aacctttgtt tgttgattct tctc (the restriction site NotI is underlined)

[0070] 2) The methicillin-resistant Staphylococcus aureus MRSA-252 strain was taken out of the -80°C freezer and spread on the MRSA-252 special solid medium, cultivated overnight at 37°C, and then ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a recombinant fusion protein HF2 which is composed of staphylococcus aureus alpha hemolysin (H1a) and a fibronectin binding protein (FNBA) segment, wherein the H1a and the FNBA are fused through a linker peptide. The protein can be used for preparing subunit vaccines and relevant detection kits capable of resisting infections of the methicillin-resistant staphylococcus aureus (MRSA). A gene engineering technology is used to recombine and express the fused protein. The method has high expression level, facilitates separation and purification and has high efficiency and safety. Animal experiment results show that the recombinant fusion protein HF2 can effectively stimulate a body to produce relatively high humoral immune response and good immune protection effect.

Description

technical field [0001] The invention belongs to the field of biotechnology, and particularly relates to a recombinant protein HF2 of a methicillin-resistant Staphylococcus aureus alpha hemolysin nontoxic mutant and an active fragment of fibronectin-binding protein A, and the invention further relates to a preparation method of the recombinant protein and its application in preparing vaccines and detection kits. Background technique [0002] Staphylococcus aureus can cause a wide range of diseases in the human body, such as bacteremia, endocarditis, folliculitis, boils, boils, carbuncles, impetigo, cellulitis, staphylomycosis, toxic shock syndrome Syndrome, central system infection, infectious eye inflammatory disease, osteomyelitis, bone and joint infection, respiratory system infection, etc., pose a great threat to human health. And because the multi-antibiotic resistance of the bacteria makes the situation more difficult to control, the options for treatment are fewer and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/63C12N1/21A61K39/085A61P31/04G01N33/569C12R1/19
Inventor冯强邹全明曾浩樊绍文卢陆董衍东鲁东水吴翼蔡昌芝
OwnerCHENGDU OLYMVAX BIOPHARM