Jade wheat farnesyl pyrophosphate synthase gene yfps and its isolation and clone, site-directed mutagenesis and detection method of enzyme function

A technology of farnesyl pyrophosphate and gene site-directed mutation, applied in the field of molecular biology

Active Publication Date: 2015-08-26
CROP RES INST SHANDONG ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, farnesyl pyrophosphate synthase genes have been isolated and cloned from 40 plant species including Arabidopsis thaliana, rice (Oryza sativa), corn (Zea mays), sorghum (Sorghum bicolor), and rubber (Heveabrasiliensis). Before the application of the present invention, there has not been disclosed or published about the isolation and cloning of the farnesyl pyrophosphate synthase gene from the wheat landrace "Yumai", gene site-directed mutation, gene prokaryotic expression, separation and purification of enzyme protein and its enzyme function In vitro testing and other research data information
In particular, the research on the site-directed mutation of the wild-type wheat farnesyl pyrophosphate synthase gene is still blank, and it is impossible to apply gene mutation technology to obtain better results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Jade wheat farnesyl pyrophosphate synthase gene yfps and its isolation and clone, site-directed mutagenesis and detection method of enzyme function
  • Jade wheat farnesyl pyrophosphate synthase gene yfps and its isolation and clone, site-directed mutagenesis and detection method of enzyme function
  • Jade wheat farnesyl pyrophosphate synthase gene yfps and its isolation and clone, site-directed mutagenesis and detection method of enzyme function

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Example 1 (Wheat leaf RNA extraction)

[0059] (1) Use vermiculite in a constant temperature incubator (28°C) to cultivate jade wheat until the three-leaf stage.

[0060] (2) Grind the leaves into powder in liquid nitrogen, and transfer them to DEPC-treated EP tubes.

[0061] (3) Add appropriate amount of RNAiso Plus.

[0062] (4) Let stand at room temperature for 5 minutes.

[0063] (5) Add 1 / 5 volume of RNAiso Plus in chloroform. Shake until creamy.

[0064] (6) Let stand at room temperature for 5 minutes.

[0065] (7) Centrifuge at 12000g for 15 minutes at 4°C.

[0066] (8) Transfer the supernatant to a new DEPC-treated EP tube, add an equal volume of isopropanol to the supernatant, and mix well. Stand at room temperature for 10 minutes.

[0067] (9) Centrifuge at 12000g for 10min at 4°C.

[0068] (10) Add 1 mL of 75% ethanol prepared with DEPC water to the precipitate. Centrifuge at 12000g for 5min at 4°C.

[0069] (11) Keep the precipitate and dry it in a...

Embodiment 2

[0071] Example 2 (synthesis of the first strand of cDNA)

[0072] Follow the instructions of the Takara reverse transcription kit.

[0073] (1) Prepare the following mixture in a microtube

[0074]

[0075] (2) Carry out denaturation and annealing reactions under the following conditions on a PCR instrument: 5 minutes at 65°C—quick cooling on ice.

[0076] (3) Prepare the following reverse transcription reaction solution in the above-mentioned Microtube tube.

[0077]

[0078] (4) Carry out the reverse transcription reaction on the PCR instrument according to the following conditions: 42°C, 60min; 70°C, 15min; 4°C cooling.

Embodiment 3

[0079] Embodiment 3 (intermediate sequence amplification)

[0080] 1 Primer design for intermediate sequences

[0081]Using Primer5.0 primer design software and DNAMAN software, primers were designed according to the highly conserved region of the amino acid sequence of FPS in plants. The upstream primer is YRF:5'TCAACGCCACTTCAGAGGAAAACCG3', whose gene sequence is shown in Seq ID No:4; the downstream primer is: YRR:5'TCCCGCTCATACTTGTGAAATGCCGT3', whose gene sequence is shown in Seq ID No:5.

[0082] The PCR system is: cDNA 2ul, buffer 1.5μL, Taq enzyme 0.3μL, dNTP 0.7μL, YRF 0.6μL, YRR 0.6μL, 10%DMSO, ddH2O 9.8μL.

[0083] The PCR program is: 94°C for 3min, 94°C for 45s, 62°C for 45s, 72°C for 1min, 72°C for 6min, 32cycles.

[0084] 2 PCR result detection of intermediate sequence

[0085] Mix 8 μL of PCR amplification product with 1 μL of bromophenol blue, point it into 1.5% agarose gel, electrophoresis at 120V for 45 min, observe and take pictures with an ultraviolet gel i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of molecular biology and relates to a detection technology for separation and clone, site-specific mutagenesis, zymoprotein prokaryotic expression, zymoprotein separation and purification and enzyme functions of a branch-point key enzyme gene participating in synthesis of an isoprenoid matter in a wheat mevalonic acid metabolic pathway. The method can provide important technical storage for further performing the gene improvement and modification, constructing an eucaryon gene expression carrier of a farnesyl diphosphate synthase gene, and converting corresponding crops; secondly can be used for obtaining plants with important commercial values in virtue of secondary metabolism, and discussing a relationship of the overexpression of the farnesyl diphosphate synthase gene in a receiver plant and important agronomic traits such as secondary metabolites, crop grain sizes and crop grain weights; and improving the yield of the crops, analyzing structures of introns, exons and promoters, studying functions of the promoters, developing related molecular markers.

Description

technical field [0001] The invention belongs to the field of molecular biology, and relates to the isolation and cloning of a key enzyme gene involved in the branch point of the synthesis of isoprenoid substances in the metabolic pathway of wheat mevalonate, the site-directed mutation of the gene, the prokaryotic expression of the enzyme protein, and the enzyme protein Separation and purification and enzyme function detection technology. Background technique [0002] Isoprenoid substances are important substances necessary for maintaining plant growth and development, photosynthesis, electron transfer, and coping with environmental stress. Such substances can be used as photosynthetic pigments (such as chlorophyll, carotenoids), growth substances and plant hormones (such as cytokinins, abscisic acid, gibberellins and brassinosteroids), part of membrane structures such as sitosterol, electron transport Receptors such as plastoquinone, receptors for glucose in glucosylation r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/54C12N15/10C12N15/70C12N9/10C12Q1/48
Inventor楚秀生李永波李玉莲樊庆琦黄承彦隋新霞郭栋高洁李根英
OwnerCROP RES INST SHANDONG ACAD OF AGRI SCI