G6PD (Glucose-6-Phosphate Dehydrogenase) deficiency gene detection membrane strip and PCR (Polymerase Chain Reaction) primer
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A technology for gene detection and deficiency, applied in DNA/RNA fragments, recombinant DNA technology, microbial determination/examination, etc., can solve problems such as missed detection, affecting the life and health of patients
Inactive Publication Date: 2014-04-02
东莞市石龙博爱医院
View PDF3 Cites 7 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
Neither of these two patents covers the more important mutation types in the Chinese population. Therefore, the products of the above two patents will cause serious missed detection, which may lead to serious consequences affecting the lives and health of some patients
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment Construction
[0081] The present invention is further described in conjunction with the following examples.
[0082] A genetic detection membrane strip for G6PD deficiency, including a basement membrane strip and specific mutation probes and normal control probes fixed on the basement membrane strip, including 17 mutation sites and 20 mutation probes in total That is, the mutation type is detected, and the 20 mutation probes are: A95G, G392T, G487A, A493G, T517C, C519T, C519G, C592T, A835G, A835T, G871A, C1004T, C1004A, C1024T, C1311T, C1360T, G1376T, G1381A, C1387T, G1388A.
[0083] The 3' end or the 5' end of the mutation probe has an amino label, and the specific sequence of the mutation probe is:
[0084] A95G GGATACACGCATATTCATCA
[0085] G392T CTCCACCTGGTGTCACAG
[0086] G871A AGGTCAAGATGTTGAAATG
[0087] C1004T CACCACCGTCACTTTTTGCA
[0088] C1004A CACCACCGACACTTTTTGCA
[0089] C1024T AGCCGTCGTCTTCTATGT
[0090] C1360T GCACTTCGTGTGCAGGTGA
[0091] G1376T GAGCTCCTTGAGGCCTGG
...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
PUM
Login to view more
Abstract
The invention relates to a gene detection membrane strip and a related primer for G6PD (Glucose-6-Phosphate Dehydrogenase) deficiency, in particular to a G6PD deficiency gene detection membrane strip and a PCR (Polymerase Chain Reaction) primer. The membrane strip and the primer detect 17 mutation sites and 20 mutation types, wherein the 20 mutation types are respectively A95G, G392T, G487A, A493G, T517C, C519T, C519G, C592T, A835G, A835T, G871A, C1004T, C1004A, C1024T, C1311T, C1360T, G1376T, G1381A, C1387T and G1388A; the PCR primer comprises 7 pairs of 14 primers; the 14 primers are simplified in the forms of G1F, G1R, G2F, G2R, G3F, G3R, G4F, G4R, G5F, G5R, G6F, G6R, G7F and G7R. The G6PD deficiency gene detection membrane strip and the PCR primer largely reduce the detection leaking frequency of patients, and protect the life and health of the patients; the detection membrane strip detects quickly and accurately, and little appears false positive and false negative.
Description
technical field [0001] The present invention relates to a gene detection membrane strip and related primers for glucose-6-phosphate dehydrogenase (glucose-6-phosphate dehydrogenase, G6PD) deficiency in medicine, in particular to a G6PD deficiency gene detection membrane strip and a Add PCR primers for gene fragments of samples to be tested. Background technique [0002] Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common X-linked incomplete dominant genetic disease in the world, and it is estimated that 400 million people are affected worldwide. The high-incidence areas of the disease include the Mediterranean coast, Africa, Southeast Asia and southern provinces of my country. Clinically, G6PD deficiency manifests as diseases such as neonatal jaundice, favism, drug-induced hemolysis, infectious hemolysis, and non-spherical cell hemolytic anemia. Serious, if not treated in time, it will endanger the life of the child. [0003] At present, commonly used c...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to view more 
Login to view more