Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A rubber tree flowering regulatory protein hbtfl1-1 and its coding gene and application

A technique for regulating flowering and encoding genes, which can be used in applications, genetic engineering, plant genetic improvement, etc., and can solve problems such as no TFL1/CEN-like gene reports yet.

Active Publication Date: 2018-03-23
RUBBER RES INST CHINESE ACADEMY OF TROPICAL AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no report about TFL1 / CEN-like gene in Hevea brasiliensis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A rubber tree flowering regulatory protein hbtfl1-1 and its coding gene and application
  • A rubber tree flowering regulatory protein hbtfl1-1 and its coding gene and application
  • A rubber tree flowering regulatory protein hbtfl1-1 and its coding gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1 Obtaining of 5 target genes of Hevea brasiliensis

[0032] According to the Rubber Tree Genome Database and Leaf Transcriptome Database of the Rubber Research Institute of the Chinese Academy of Tropical Agricultural Sciences, contigs obtained through homologous alignment are then spliced, and then the open reads are predicted by NCBI online software and specific primers are designed to obtain contigs containing complete open reads. DNA sequence and cDNA sequence of the reading frame.

[0033] The specific method is as follows:

[0034] Acquisition of open reading frames for 5 genes

[0035] The five gene-specific primers are as follows:

[0036] HbTFL1-1OF (EcoRI):G ATGTCAAGGATCATGGAGCC

[0037] HbTFL1-1OR(XbaI):GC TCATTCTTCTTCTTGCAGCAGTTTT

[0038] HbTFL1-2OF(EcoRI):G ATGGCAAGAATAATAGAACCTCT

[0039] HbTFL1-2OR(XbaI):GC TTAGCGCCTTCTTGCAGCAGTT

[0040] HbTFL1-3OF(EcoRI):G ATGGCAAGAATAATAGAACCTCT

[0041] HbTFL1-3OR(XbaI):GC TTAGCGTCTTCTT...

Embodiment 2

[0102] Example 2 Analysis of tissue-specific expression of 5 target genes

[0103] In this study, 3-month-old rubber tissue culture seedlings were selected as experimental materials. The roots, stems, buds, bronze leaves, discolored leaves, light green leaves and stable leaves were collected respectively, and their RNAs were extracted for future use.

[0104] The RNA obtained above was digested with DnaseI and then reverse transcribed according to the reverse transcription kit. The tissue-specific expression analysis of five target genes was performed by fluorescence quantitative technology.

[0105] The five gene fluorescent quantitative primers are:

[0106] HbTFL1-1QF:CCTCCTTAATCCCTGGCTACG,

[0107] HbTFL1-1QR:ACATCGCCTACAACTCTCCCT,

[0108] HbTFL1-2QF:GCCACATTTGGAAGGGAGATAG,

[0109] HbTFL1-2QR: TAACACTTATTTATTGAAGGCCACTTG,

[0110] HbTFL1-3QF: ATACACCTCTTAGCCAGACGCTC,

[0111] HbTFL1-3QR:TGTCGCCTCCTTGGACCTCA,

[0112] HbCEN1QF:CTAATGGCGAAGACAACAGAT,

[0113] HbCE...

Embodiment 3

[0117] Example 3 Analysis of spatiotemporal expression patterns of 5 target genes

[0118] Taking 3 months, 2 years and 10 years as the research objects, the roots, stems, buds, bronze leaves, color-changing leaves, light green leaves and stable leaves of each age group were collected in the flowering season (March) respectively, and 10 years old. RNA was extracted from the male and female flowers of the annual tree when they bloomed.

[0119] The RNA obtained above was digested with DnaseI and then reverse transcribed according to the reverse transcription kit. The temporal and spatial expression patterns of the five target genes were analyzed by fluorescence quantitative technology.

[0120] The results showed that: in the flowering season, for TFL1-like genes, the expressions of HbTFL1-1, HbTFL1-2 and HbTFL1-33 genes in their respective vegetative organs in 10-year-old trees were significantly lower than those in 3-month-old and 2-year-old trees . In the newly differenti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a rubber tree blooming regulation protein HbTFL1-1, an encoding gene thereof, and an application of the gene. The amino acid sequence of the blooming regulation protein HbTFL1-1 is represented by SEQ ID No.3, and the encoding gene of the protein is used to transform plants in order to obtain transgenic plants with delayed blooming stage.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a rubber tree flowering regulation protein HbTFL1-1, its coding gene and its application. Background technique [0002] TFL1 / CEN-like genes widely exist in flowering plants and are a very important flowering suppressor. They achieve the purpose of inhibiting flowering by inhibiting the downstream floral organ determination genes AP1 and LFY genes of the FT gene. [0003] In Arabidopsis tfl1 mutants, the vegetative phase of Arabidopsis is significantly shortened, concomitant with the transition of the inflorescence from an infinity to a terminal inflorescence. Therefore, it is proved that Arabidopsis TFL1 gene has the function of simultaneously regulating vegetative growth and inflorescence development (BradleyD, Ratcliffe O, Vincent C, Carpenter R, Coen E (1997) Inflorescence commitment and architecture in Arabidopsis. Science 275:80-83). In pea, two TFL1-like genes were shown to r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82C12N1/21A01H5/02A01H6/20
CPCC07K14/415C12N15/827
Inventor 华玉伟黄华孙毕政鸿黄天带应佳志陈涛
Owner RUBBER RES INST CHINESE ACADEMY OF TROPICAL AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com