Nucleic acid complex, method for forming nucleic acid hybridization, pharmaceutical composition, nucleic acid probe, and complementary-strand nucleic acid complex
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
examples
[0113]By way of example, the present disclosure will now be specifically described below. The present disclosure is, however, not limited to these examples.
example a
(Outline of Oligonucleotides Synthesized)
[0114]As target nucleic acids (target RNAs), miR21 (SEQ ID NO: 1) and miR21-M (miR21 with one base mismatch) (SEQ ID NO: 2) (both have 22 mer) were selected; and an oligonucleotide complementary to miR21 or miR21-M was synthesized.
[0115]The base sequences of miR21 and miR21-M are shown below.
miR21:(SEQ ID NO: 1)5′ UAGCUUAUCAGACUGAUGUUGA 3′miR21-M:(SEQ ID NO: 2)5′ UAGCUUAUCACACUGAUGUUGA 3′
[0116]To be more specific with regard to the oligonucleotide complementary to miR21 or miR21-M, products with one cross-link (CL1) having a single-stranded nucleic acid comprising a base sequence that is completely or sufficiently complementary to the base sequence of a target nucleic acid (hereinafter referred to simply as a “complementary binding-like sequence” in the present Examples) and a double-stranded cross-linking adapter sequence at the 5′ side or the 3′ side (including those having the cross-linking adapter sequence with a hairpin loop structure an...
example b
(Tm Measurement)
[0191]With regard to the molecules of the Examples and Comparative Examples which had been prepared in Example A, a melting curve was measured. As nucleic acids to be targeted, miR21 (SEQ ID NO: 1) and miR21-M (SEQ ID NO: 2) were selected.
[0192]The molecules (130 pmol) of Examples 1 to 15, and 17 or Comparative Examples 1 to 11 and 13 to 17 were mixed with miR-21 or miR-21-M (130 pmol) and the mixture was dissolved in a Tm measurement buffer (10 mM NaCl, 10 mM Na cacodylate (pH 7.0), 130 μL). The sample was heated at 90° C. for three minutes, then allowed to gradually cool to room temperature to anneal, and then left to stand at room temperature for five minutes; and 125 μL of the resultant was placed in a measurement cuvette to measure the melting curve. The measurement was carried out using UV2500PC (manufactured by Shimadzu Corporation) in a temperature range of 5° C. to 90° C. in conditions of a temperature rate of 0.5° C. / min, a measurement interval of 0.2° C., ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More