Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for detecting fat deposition of Bama miniature pig by virtue of LPL (Lipoprotein Lipase) gene

A Bama-flavored pig, fat deposition technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve problems such as reducing the value of livestock products and inducing diseases of livestock and poultry

Inactive Publication Date: 2015-10-14
GUANGXI UNIV
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, excessive fat deposition will not only induce livestock and poultry diseases, but also reduce the value of livestock products

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting fat deposition of Bama miniature pig by virtue of LPL (Lipoprotein Lipase) gene
  • Method for detecting fat deposition of Bama miniature pig by virtue of LPL (Lipoprotein Lipase) gene
  • Method for detecting fat deposition of Bama miniature pig by virtue of LPL (Lipoprotein Lipase) gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0020] 1. Research Design

[0021] Bamaxiang pigs were fed normally, collected at 3 months, 5 months, and 8 months to detect the expression level of lipoprotein lipase LPL, and the relationship between the expression level of gene LPL and the fat deposition rate was investigated.

[0022] Using the LPL sequence of pig (sus scrofa) published in the NCBI database (sequence accession number: Gene ID: 397537; see the website: NCBI data http: / / www.ncbi.nlm.nih.gov / ), successfully designed a pair of The specific quantitative primers can detect the relative expression level in the pig genome. The LPL-specific fragment of pig (sus scrofa) has a full-length sequence of 2946bp. The pig's housekeeping gene glyceraldehyde-3-dehydrogenase gene GAPDH-specific fragment has a full-length sequence of 1341bp.

[0023] The primer pair for quantitative PCR above-mentioned LPL specific fragment, its base sequence is:

[0024] Forward primer (P1): TGCTGGGAATCCAAACTGAA;

[0025] Reverse primer (...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting fat deposition of a Bama miniature pig by virtue of the LPL (Lipoprotein Lipase) gene. The method is combined with the research conclusion that the LPL gene is in positive correlation with fat deposition, and fat deposition of the Bama miniature pig is detected based on the expression level of the LPL gene in adipose tissues. The method has the characteristics of being rapid, accurate and convenient to operate and does not influence the normal growth of the pig; the method is suitable for dynamically monitoring fat deposition of a pig in a cultivating process, so that the growing condition of the pig can be mastered at any time, fat excessive deposition is prevented, and thus the optimal carcass lean meat rate of the Bama miniature pig is obtained.

Description

technical field [0001] The invention belongs to the field of detection of fat deposition in pigs, in particular to a method for detecting fat deposition in Bamaxiang pigs with gene LPL. Background technique [0002] Through in-depth research in recent years, people have gradually realized that adipose tissue is not only an energy metabolism place for storing lipids, but also has an important secretory function. It can secrete a variety of physiologically active factors, such as leptin (Leptin), resistin , adiponectin (Adiponectin), tumor necrosis factor (Tumour necrosis factor-alpha, TNF-α), interleukin-6 (Interleukin-6, IL-6), DFF45-like effector C (Cidec) that induces cell death and Lipoprotein lipase (LPL). These adipocyte-secreted factors combine with corresponding receptors distributed in organs and tissues through autocrine or paracrine effects, affect and regulate the metabolism of adipose tissue or other tissues and even the whole animal body, and are effective for ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6888C12Q2600/124C12Q2600/158
Inventor 李一星俞林周磊
Owner GUANGXI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More