Nucleic acid molecule CTL4HSH1, and preparation method and application thereof

A nucleic acid molecule and inhibitor technology, applied in the field of cell biology and medicine, can solve problems such as large toxic side effects, lack of tumor cell specificity, insensitivity to chemotherapy and radiotherapy, etc.

Inactive Publication Date: 2018-03-27
FUDAN UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, in clinical practice, chemotherapy and radiotherapy are still the first choice for the treatment of cancer. Although the two have achieved considerable curative effect on tumor treatment, they have relatively large toxic and side effects due to the lack of specificity for tumor cells and certain tumors. The insensitivity of cells to chemotherapy and radiotherapy treatment thus largely limits their clinical application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 Design and screening of CTL4 inhibitory molecules

[0033] GAACAGAAGCTGCACAGATGT (SED ID NO 1) in the CTL4 sequence was used as a target to screen inhibitory molecules, and the nucleic acid molecule whose sequence was ACCTCGAACAGAAGCTGCACAGATGTTCAAGAGACATCTGTGCAGCTTCTGTTCTT (SED ID NO 2) or CAAAAAGAACAGAAGCTGCACAGATGTCTCTTGAACATCTGTGCAGCTTCTGTTCG (SED ID NO 3) was used as a CTL4 candidate HSH1 inhibitor;

[0034] 293T cells were planted in 24-well plates with a seeding density of 2*104 / well;

[0035]The CTL4HSH1 fragment was repeatedly transfected 24h (hour), 72h, and 120h after seeding the plate, and dissolved in Opti-MEM (Opti-MEM IReduced Serum Medium, Invitrogen Company, 31985-070) as a solvent to make the final concentration reach 40nM. The transfection reagent used lipofectamin2000 (11668-027, Invitrogene);

[0036] The cells were digested 24h, 72h, and 120h after the first transfection, and some (5*104) cell samples were collected at 72h and 120h. Wes...

Embodiment 2

[0038] Example 2 The cellular level screening experiment of the subtractive effect on CTL4 gene expression

[0039] Experimental steps:

[0040] 293T cells (purchased from the Chinese Academy of Sciences Cell Bank) were planted in a 96-well plate with a seed plate density of 0.8*104 / well;

[0041] After 24 hours, the lentivirus (lentivirus, Jikai Company) carrying CTL4HSH1 was transfected into the cells. The titer of Lentivirus is 106TU / ul, and the MOI is 100, that is, 80ul of virus solution is added to each well; the specific transduction method is as follows:

[0042] Replace each well of cells with 50ul of fresh medium (pH7.0), add an appropriate amount of virus solution, and add 50ul of medium to each well after 7-8 hours. Change the medium after 24h. Observe the GFP (green fluorescence) fluorescence for 48-72 hours to detect the transduction efficiency;

[0043] The cells were expanded and cultured, and the cells were sorted by GFP green fluorescence by flow cytometry...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention specifically relates to a nucleic acid molecule which has activity in inhibition of the expression of CTL4 genes in in-vitro cells, belonging to the fields of cytobiology and medicine. Atarget element inhibited by the nucleic acid molecule contains a sequence as shown in SEQ ID No. 1. The invention provides a recombinant vector containing the nucleic acid molecule and a kit capableof inhibiting the expression of CTL4 genes in in-vitro cells. The kit comprises the nucleic acid molecule. The nucleic acid molecule has a sequence as shown in SEQ ID No. 2 or SEQ ID No. 3. The invention also provides a preparation method and application of the nucleic acid molecule. Results of experiments prove that the nucleic acid molecule can inhibit at least 45% of the expression quantity ofCTL4 genes in in-vitro cells, thereby maintaining the normal physiological status of target cells.

Description

technical field [0001] The invention belongs to the fields of cell biology and medicine, and specifically relates to a nucleic acid molecule and its preparation method and application. Background technique [0002] The prior art discloses that a tumor is an abnormal lesion formed by a certain cell in a local tissue losing normal regulation of its growth at the gene level under the action of various carcinogenic factors, resulting in abnormal clonal proliferation. Statistics show that the number of cancer cases in my country is quite large, accounting for 55% of the world's cases; tumor diseases have now risen to the No. 2 "killer" in the world, and its death toll is second only to cardiovascular diseases. [0003] Studies have shown that benign tumors have less impact on the body, mainly showing symptoms of local compression and obstruction. Malignant tumors have a serious impact on the body due to their immature differentiation, rapid growth, infiltration and damage to the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/63C12N5/10
CPCC12N15/1138C12N2310/10
Inventor朱波彭景涛
OwnerFUDAN UNIV