Nucleic acid molecule CTL4HSH1, and preparation method and application thereof
A nucleic acid molecule and inhibitor technology, applied in the field of cell biology and medicine, can solve problems such as large toxic side effects, lack of tumor cell specificity, insensitivity to chemotherapy and radiotherapy, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0032] Example 1 Design and screening of CTL4 inhibitory molecules
[0033] GAACAGAAGCTGCACAGATGT (SED ID NO 1) in the CTL4 sequence was used as a target to screen inhibitory molecules, and the nucleic acid molecule whose sequence was ACCTCGAACAGAAGCTGCACAGATGTTCAAGAGACATCTGTGCAGCTTCTGTTCTT (SED ID NO 2) or CAAAAAGAACAGAAGCTGCACAGATGTCTCTTGAACATCTGTGCAGCTTCTGTTCG (SED ID NO 3) was used as a CTL4 candidate HSH1 inhibitor;
[0034] 293T cells were planted in 24-well plates with a seeding density of 2*104 / well;
[0035]The CTL4HSH1 fragment was repeatedly transfected 24h (hour), 72h, and 120h after seeding the plate, and dissolved in Opti-MEM (Opti-MEM IReduced Serum Medium, Invitrogen Company, 31985-070) as a solvent to make the final concentration reach 40nM. The transfection reagent used lipofectamin2000 (11668-027, Invitrogene);
[0036] The cells were digested 24h, 72h, and 120h after the first transfection, and some (5*104) cell samples were collected at 72h and 120h. Wes...
Embodiment 2
[0038] Example 2 The cellular level screening experiment of the subtractive effect on CTL4 gene expression
[0039] Experimental steps:
[0040] 293T cells (purchased from the Chinese Academy of Sciences Cell Bank) were planted in a 96-well plate with a seed plate density of 0.8*104 / well;
[0041] After 24 hours, the lentivirus (lentivirus, Jikai Company) carrying CTL4HSH1 was transfected into the cells. The titer of Lentivirus is 106TU / ul, and the MOI is 100, that is, 80ul of virus solution is added to each well; the specific transduction method is as follows:
[0042] Replace each well of cells with 50ul of fresh medium (pH7.0), add an appropriate amount of virus solution, and add 50ul of medium to each well after 7-8 hours. Change the medium after 24h. Observe the GFP (green fluorescence) fluorescence for 48-72 hours to detect the transduction efficiency;
[0043] The cells were expanded and cultured, and the cells were sorted by GFP green fluorescence by flow cytometry...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More