Expression method of glucosal related protein and application thereof

A technology for regulating proteins and uses, applied in the field of biomedicine, can solve the problems of loss of tumor antigen peptides, difficulty in clinical application, limitation of HSP extraction amount, etc., and achieve high infection efficiency

Inactive Publication Date: 2006-07-19
李川源 +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the extraction of HSP from tumor tissue has great limitations in practical application.
Such as the loss of tumor antigen peptides during the purification process, the amount of HSP ex...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expression method of glucosal related protein and application thereof
  • Expression method of glucosal related protein and application thereof
  • Expression method of glucosal related protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] 1. PCR amplification of mouse sugar regulatory protein gene

[0044] Using the DNA of 4T1 cells as a template, the following primers were used to amplify the GRP gene by PCR, and the C-terminal coding KDEL amino acid sequence (AAA GAT GAA TTA) was removed, which was called secreted GRP (sGRP).

[0045] Upstream primer 5'GCGTCGACACGCACCATGAGGGTCCTGTG 3'

[0046] Downstream primer 5′ATAGTTTAGCGGCCGCTTACTCTGTAGATTCCTTTTCTG 3′

[0047] 2. After the PCR product was digested with the restriction endonuclease NotI, it was connected with the enhanced green fluorescent protein (EGFP) gene amplified by PCR from the plasmid pEGFPN1 (Clontech) through the NotI site to form a fusion gene (sGRP-GFP), In this way, the expression of fluorescent protein can be used as a marker of sugar-regulated protein expression, which is convenient for direct observation.

[0048] 3. After the fusion gene was cut with restriction enzymes Sal I and BamHI, it was connected to the multiple cloning sit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The express and adjust method for GRP in bio-medicine field comprises: modifying the GRP into secretory protein to load into the tumor cell cultured externally; then, the altumen stimulates the body anti-tumor immunity function to prepare tumor-vaccine and cure tumor; while injecting directly the albumen adenovirus to infect the tumor cell and express the albumen for tumor treatment with chemotherapy and radiotherapy.

Description

technical field [0001] The invention belongs to the field of biomedicine and relates to a method for expressing a sugar-regulating protein, in particular to a method for expressing a sugar-regulating protein in tumors and its application. Background technique [0002] Tumor cells contain a large number of gene mutations, about 11,000 mutations / cell, so each tumor has its own unique antigen peptide, which has the potential to cause tumor immune response. However, in general, tumor cells cannot elicit a sufficient immune response, and one of the most important reasons is that the function of antigen-presenting cells is insufficient or unwell. Therefore, enhancing the presentation of tumor antigens may elicit effective anti-tumor immune responses. [0003] Members of the heat shock protein (Heat Shock Protein, HSP) family, such as HSP 70 and HSP 90, have the function of molecular chaperon (chaperon), assisting newly synthesized proteins to complete the secondary and tertiary s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/09C12N15/861A61K39/00A61K38/17A61P35/00
Inventor 李川源刘珊玲
Owner 李川源
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap