Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for eliminating capability of klebsiella pneumoniae in synthesizing 2,3-butanediol and acetoin

A technology of Klebsiella pneumoniae and propylene glycol, which is applied in the field of eliminating the synthesis of Klebsiella pneumoniae 2, and can solve problems such as the ability to eliminate the synthesis of Klebsiella pneumoniae.

Active Publication Date: 2015-02-04
SHANGHAI ADVANCED RES INST CHINESE ACADEMY OF SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no research report on the elimination of the synthesis ability of these two substances of Lebsiella pneumoniae

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for eliminating capability of klebsiella pneumoniae in synthesizing 2,3-butanediol and acetoin
  • Method for eliminating capability of klebsiella pneumoniae in synthesizing 2,3-butanediol and acetoin
  • Method for eliminating capability of klebsiella pneumoniae in synthesizing 2,3-butanediol and acetoin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Embodiment 1 eliminates the method for Klebsiella pneumoniae CGMCC1.6366 synthetic 2,3-butanediol and acetoin ability

[0018] The CGMCC1.6366 strain in this example is preserved by the China General Microorganism Culture Collection and Management Center, and has ampicillin resistance.

[0019] The method for eliminating the ability of Klebsiella pneumoniae CGMCC1.6366 to synthesize 2,3-butanediol and acetoin in the present embodiment, the specific steps are as follows:

[0020] 1. Utilize PCR to amplify Klebsiella pneumoniae acetolactate decarboxylase gene (budA), connect to the cloning vector by TA cloning method, and carry out DNA sequence determination.

[0021] According to Klebsiella pneumoniae MGH78578 (Genbank: CP000647) genome information, design acetolactate decarboxylase PCR primers, upstream primer budA-s: GAAGATCAGAACATCGCCAGA (shown in SEQ ID NO.1), downstream primer budA-a: CTCTGATGGACCTGCTTCGCCTTAT (SEQ ID NO.2 shown).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for eliminating capability of klebsiella pneumoniae in synthesizing 2,3-butanediol and acetoin, comprising the following step of inactivating acetolacetate decearboxylase gene in a synthesis route of 2,3-butanediol by lebsiella pneumoniae to cut off the catalytic reaction that acetolactic acid is converted into acetoin. According to the method, when 1,3-propylene glycol is synthesized from glycerol by the klebsiella pneumoniae, the synthesis of byproducts, i.e. 2,3-butanediol and acetoin, can be eliminated, and the conversation rate of glycerol to 1,3-propylene glycol can be improved.

Description

technical field [0001] The invention relates to a method for eliminating metabolic byproducts of Klebsiella pneumoniae, in particular to a method for eliminating the ability of Klebsiella pneumoniae to synthesize 2,3-butanediol and acetoin. Background technique [0002] Klebsiella pneumoniae is a Gram-negative bacterium taxonomically belonging to the same genus as Escherichia coli. Klebsiella pneumoniae can metabolize glycerol to produce 1,3-propanediol, and has a high production intensity and conversion rate, and related research has received great attention. Klebsiella pneumoniae uses glycerol to synthesize 1,3-propanediol and also synthesizes 2,3-butanediol, acetoin (3-hydroxy-2-butanone), ethanol, succinic acid, acetic acid and lactic acid, etc. By-products, the synthesis of these by-products consumes a large amount of substrates and simultaneously brings a heavy burden to the separation and extraction of 1,3-propanediol [Xiu, Z.L. and A.P.Zeng, Present state and perspe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/90C12N1/21C12R1/22
Inventor 郝健魏东史吉平姜标
Owner SHANGHAI ADVANCED RES INST CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com