Preparation method of chimeric vaccine by using Ii-Key active tetrapeptide carrying Fabricius bursa VP2 and newcastle disease HN antigen peptide epitope

A chimeric vaccine and bursa of fabric technology, applied in chemical instruments and methods, viral antigen components, peptides, etc., to achieve good immune effect, easy preparation, and strong specificity.

Active Publication Date: 2014-07-23
ANHUI AGRICULTURAL UNIVERSITY
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, it is still blank to design a vaccine that can carry two viral epitopes and significantly enhance the immune response by linking the two epitopes with the key motif of the invariant chain (Ii-Key) at the same time.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of chimeric vaccine by using Ii-Key active tetrapeptide carrying Fabricius bursa VP2 and newcastle disease HN antigen peptide epitope
  • Preparation method of chimeric vaccine by using Ii-Key active tetrapeptide carrying Fabricius bursa VP2 and newcastle disease HN antigen peptide epitope
  • Preparation method of chimeric vaccine by using Ii-Key active tetrapeptide carrying Fabricius bursa VP2 and newcastle disease HN antigen peptide epitope

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0045] Below by embodiment the present invention will be further described, but do not limit the present invention.

[0046] The experimental methods in the following examples are conventional methods unless otherwise specified.

[0047] The percentages in the following examples are all mass percentages unless otherwise specified.

[0048] The proportions in the following examples are volume proportions unless otherwise specified.

[0049] 1. Chimera design and gene synthesis

[0050] Design VP2 first 197-209 and HN 345-353 The tandem epitope, the epitope is linked by AAY linking peptide (Ala-Ala-Tyr), and the Ii-Key is then linked with the above tandem epitope. The specific sequence is as follows: 5'-CG gaattc CTTCGCATGAAGGCCGCCTACTGTGACAGCAGTGACAGGCCCAGAGTCTACACTATAACTGCCGCCTACGATGGACAAGATTACCAAATTCGGTGA gtcgac gcGT-3'

[0051] EcoR I was added at the 5' end of the gene sequence, a stop codon TGA and a SalI restriction site were added at the 3' end, the whole gene w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method of chimeric vaccine by using Ii-Key active tetrapeptide carrying Fabricius bursa VP2 and newcastle disease HN antigen peptide epitope, which is characterized in that the chimera gene of Ii-Key and chicken infectious Fabricius bursa VP2 peptide epitope (197-209) and newcastle disease HN antigen peptide epitope (345-353) is artificially synthesized, a pET-32a prokaryotic expression vector is respectively inserted, then escherichia coli Rosetta is conversed, and chimera gene is purified through a nickel affinity column chromatography, an enzyme-linked immunosordent assay(ELISA) is employed for detecting antibody level in mice with recombinant protein immunization SPF grade BALb / c; and vaccine is compared with a simple VP2197-209 / HN345-353 series epitope control group. The antibody titer of the chimeric vaccine group based on active Ii-Key is increased by 13.72 times on average. The chimeric vaccine has the characteristics of strong specialty, easy preparation and good immunization effect.

Description

technical field [0001] The invention belongs to the technical field of vaccine preparation, and in particular relates to constructing a chimera vaccine of active tetrapeptide Ii-Key (LRMK), chicken infectious bursal virus VP2 peptide epitope and Newcastle disease virus HN peptide epitope. Background technique [0002] Major Histocompatibility Complex (MHC) class II molecules bind antigenic peptides in antigen-presenting cells and present them to the cell surface to activate immune responses, while partner molecules are required before binding antigenic peptides- The invariant chain (Ii) occupies the antigen-binding groove of its α and β chains and forms a nonamer in the endoplasmic reticulum. The invariant chain mainly assists MHC class Ⅱ molecules to transport exogenous antigenic peptides and prevents the binding of endogenous antigenic peptides. Infectious bursal disease virus (IBDV) and Newcastle disease virus (NDV) are common pathogens of important infectious diseases t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K39/17A61K39/12A61P31/14G01N33/68C07K19/00C12N15/62C12N15/70
Inventor刘雪兰徐姗姗李槿年许发芝叶红
OwnerANHUI AGRICULTURAL UNIVERSITY