Delivery, engineering and optimization of tandem guide systems, methods and compositions for sequence manipulation

A composition and engineering technology, applied in the direction of drug combination, genetic engineering, biochemical equipment and methods, etc.

Inactive Publication Date: 2016-10-26
THE BROAD INST INC +2
View PDF41 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

While genome editing technologies such as designer zinc fingers, transcriptional activator-like effectors (TALEs), or homing meganucleases are available for generating targeted genome perturbations, affordable New genome engineering technology that is easy to establish, scalable, and convenient for targeting multiple locations within the eukaryotic genome

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Delivery, engineering and optimization of tandem guide systems, methods and compositions for sequence manipulation
  • Delivery, engineering and optimization of tandem guide systems, methods and compositions for sequence manipulation
  • Delivery, engineering and optimization of tandem guide systems, methods and compositions for sequence manipulation

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0509] Example 1: Method improvements for simplified cloning and delivery.

[0510] Instead of encoding the U6-promoter and guide RNA on a plasmid, Applicants amplified the U6-promoter with DNA oligonucleotides for addition to the guide RNA. The resulting PCR product can be transfected into cells to drive expression of the guide RNA.

[0511] Exemplary primer pairs that allow generation of a PCR product consisting of a U6-promoter::guide RNA targeting the human EMX1 locus:

[0512] Forward primer: AAACTCTAGAGagggcctatttcccatgattc

[0513] Reverse primer (carries guide RNA, which is underlined):

[0514] acctctag AAAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATG CTGTTTTGTTTCCAAAACAGCATAGCTCTAAAACCCTAGTCATTGGA GGTGACGGTGTTTCGTCCTTTCCACaag

example 2

[0515] Example 2: Method improvements for improving activity:

[0516] Instead of expressing guide RNA in eukaryotic cells using the pol3 promoter (specifically RNA polymerase III (e.g. U6 or H1 promoters), Applicants expressed T7 polymerase in eukaryotic cells to drive the expression of guide RNA using the T7 promoter Express.

[0517] An example of this system can involve the introduction of three pieces of DNA:

[0518] 1. Cas9 expression vector

[0519] 2. Expression vector of T7 polymerase

[0520] 3. Expression vector comprising guide RNA fused to the T7 promoter

example 3

[0521] Example 3: Method improvement for reducing the toxicity of Cas9: Cas9 was delivered in the form of mRNA.

[0522] Delivery of Cas9 as mRNA allows for transient expression of Cas9 in cells to reduce toxicity. For example, the following primer pairs can be used to amplify humanized SpCas9:

[0523] Forward primer (to be added to the T7 promoter for in vitro transcription): TAATACGACTCACTATAGGAAGTGCGCCACCATGGCCCCAAAGAAGAAGCGG

[0524] Reverse primer (to add to polyA tail): GGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTttcttaCTTTTCTTTTTTGCCTGGCCG

[0525] Applicants transfected Cas9 mRNA into cells with guide RNA in the form of an RNA or DNA cassette to drive expression of the guide RNA in eukaryotic cells.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides for delivery, engineering and optimization of systems, methods, and compositions for manipulation of sequences and / or activities of target sequences. Provided are vectors and vector systems, some of which encode one or more components of a CRISPR complex, as well as methods for the design and use of such vectors. Also provided are methods of directing CRISPR complex formation in prokaryotic and eukaryotic cells to ensure enhanced specificity for target recognition and avoidance of toxicity.

Description

[0001] Related applications and cited references [0002] Priority is claimed from the following U.S. provisional applications: 61 / 836,123 filed June 17, 2013; 61 / 847,537 filed July 17, 2013; 61 / 862,355 filed August 5, 2013; August 2013 61 / 862,468 filed on 5; 61 / 871,301 filed on August 28, 2013; 61 / 915,407 filed on December 12, 2013; and 61 / 979,942 filed on April 15, 2014. [0003] The aforementioned applications, and all documents cited therein or during their prosecution or ("Application Citations") and all documents cited or referenced in these Application Citations, and all documents cited or referenced herein ( "documents cited herein"), all documents cited or referenced in documents cited herein, together with any manufacturer's instructions for any product mentioned herein or incorporated by reference in any document herein, The descriptions, product specifications, and product tables are hereby incorporated by reference herein and may be employed in the practice of the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/63C12N9/22C12N15/10
CPCC12N9/22C12N15/63C12N15/102C12N2310/20A61P43/00C12N2310/3519C12N15/1082C12N15/907C12N2800/80
Inventor张锋林致宇然霏
OwnerTHE BROAD INST INC