Method and primers for detecting dyskeratosis congenita (DC)-related gene WRAP 53

A gene, wrap53-exon2-f technology, applied in the field of gene mutation primers, which can solve the problems of few gene detection and small number of cases, etc.

Inactive Publication Date: 2017-05-10
FUZHOU ADICON CLINICAL LAB INC
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the vast majority of DC cases reported in the domestic literature are clinical cases with skin involvement around the age of 30, the number of cases is small, and genetic testing is seldom performed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and primers for detecting dyskeratosis congenita (DC)-related gene WRAP 53
  • Method and primers for detecting dyskeratosis congenita (DC)-related gene WRAP 53
  • Method and primers for detecting dyskeratosis congenita (DC)-related gene WRAP 53

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0115] A primer for detecting the polymorphic mutation site of the WRAP53 gene, the design of the primer is an amplification primer designed for the whole exon of WRAP53, including:

[0116] The primers for amplifying the whole exon sequence of WRAP53 gene, its base sequence is:

[0117] WRAP53-Exon1A-F: TGTAAAACGACGGCCAGTGGGAACGGGAAACCTTCTAA

[0118] WRAP53-Exon1A-R: AACAGCTATGACCATGGACAGCAGTCCGGAGCTAAC

[0119] WRAP53-Exon1B-F: TGTAAAACGACGGCCAGTCTAATCTCCGCTGTGCTTCC

[0120] WRAP53-Exon1B-R: AACAGCTATGACCATGTCTTCTGCAGGAAGGCTTGT

[0121] WRAP53-Exon1C-F: TGTAAAACGACGGCCAGTGGGACCCAGTTTCTCTCTCC

[0122] WRAP53-Exon1C-R: AACAGCTATGACCATGCTGGAGAAGTGGGTCTCAGG

[0123] WRAP53-Exon2-F: TGTAAAACGACGGCCAGTGTGGAGTCTGGGGAGATGAA

[0124] WRAP53-Exon2-R: AACAGCTATGACCATGGGGCATCCCTCTCCTAGAAA

[0125] WRAP53-Exon3-F: TGTAAAACGACGGCCAGTCAGCCCTAGCCCTACACTTG

[0126] WRAP53-Exon3-R: AACAGCTATGACCATGTGCTGCCACAAGAAATTCAC

[0127] WRAP53-Exon4-F: TGTAAAACGACGGCCAGTTCTGAGCTCACCCTTGAACA

...

Embodiment 2

[0153] Operation process of blood / cell / tissue genomic DNA extraction kit (Tiangen Biology):

[0154] (1) Genomic DNA extraction from whole blood

[0155] 1) Add 20μl QIAGEN Protease (or proteinase K) to the bottom of a 1.5ml centrifuge tube. .

[0156] 2) Add 200 μl of plasma to the centrifuge tube.

[0157] 3) Add 200 μl Buffer AL and shake for 15 seconds. (Note: Do not add QIAGEN Protease or proteinase K directly to Buffer AL. If the sample size is large, increase QIAGEN Protease and Buffer AL proportionally.)

[0158] 4) Water bath at 56°C for 10 minutes, and then briefly centrifuge to remove the liquid on the inner edge of the centrifuge tube cover.

[0159] 5) Add 200 μl of ethanol (96%-100%), shake for 15 s, and briefly centrifuge to remove the liquid along the inner edge of the centrifuge tube cover.

[0160] 6) Carefully add the mixture obtained above (including the precipitate) into the QIAamp micro spin column (do not wet the edge of the spin column). Put the sp...

Embodiment 3

[0217] In order to verify the feasibility of the primers and the entire detection system, 13 cases of clinical samples were taken (two repetitions were established for each pair of primers, and each group was numbered 1-13 by primers) according to the reagents and methods of Examples 1 and 2 to extract genomes and prepare reagents , amplification and sequencing. Take sample 4 and add primers for amplification, and the electrophoresis results are as follows: figure 2 and image 3 As shown, it shows that the primers of the present invention can effectively amplify blood samples, and the band is single. The sequencing results are shown in the table below.

[0218]

[0219]

[0220] Figure 4 It shows the front and back sequencing screenshots of the WRAP53 exon 2 wild type of sample 4, indicating that the peaks of the sequencing results are clear and there are no interferences such as miscellaneous peaks and heavy peaks that affect the results.

[0221] It can be seen f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method and primers for detecting the mutation of a dyskeratosis congenita (DC)-related gene WRAP 53. The primers comprise 13 pairs of primers for amplifying an all-exon sequence of the gene WRAP 53, and a sequencing primer. The method can rapidly detect the all-exon of the gene WRAP 53 and the relevant mutation by adopting a Sanger sequencing technique. After the method and the primers are used, the detection result is accurate; the method and the primers have important reference significance for realizing the early diagnosis of the DC, reducing misdiagnosis and missed diagnosis and carrying out treatment on the DC.

Description

technical field [0001] The invention belongs to the field of life science and biotechnology, and particularly relates to a primer and a method for detecting gene mutations related to congenital dyskeratosis. Background technique [0002] Dyskeratosis congenita (dskeratosiseongenita, DC) is a bone marrow failure syndrome with genetic heterogeneity, with an incidence of about 1 / 1 million. About 80% to 90% of typical DC patients have the triad of abnormal skin and mucous membranes, which are manifested as reticular pigmentation of the skin, atrophy of the finger (toe) nails, and leukoplakia of the oral mucosa. At present, the mutated genes reported in the literature that can cause DC mainly include CTC1, DKC1, TERC, TERT, TINF2, NHP2, NOP10 and WRAP53. It has been reported in the literature that these genes have three modes of inheritance, which are X-linked recessive inheritance, autosomal recessive inheritance, and autosomal dominant inheritance. However, the genetic charac...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/686C12Q1/6883C12Q2600/156C12Q2563/107C12Q2545/114C12Q2531/113
Inventor黄开新单战王淑一
OwnerFUZHOU ADICON CLINICAL LAB INC