Aptazyme modified sgRNA carrier with theophylline regulated expression and application

An aptamer and vector technology, applied in DNA/RNA fragments, recombinant DNA technology, introduction of foreign genetic material using vectors, etc.

Active Publication Date: 2017-10-13
SHAANXI NORMAL UNIV
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Some researchers also use the tetracycline regulatory system to regulate the expression of Cas9 protein or sgRNA to regulate CRISPR / Cas9 activity, but such a regulatory system will require the introduction of additional cis-regulatory elements and trans-regulatory factors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Aptazyme modified sgRNA carrier with theophylline regulated expression and application
  • Aptazyme modified sgRNA carrier with theophylline regulated expression and application
  • Aptazyme modified sgRNA carrier with theophylline regulated expression and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] The carrier constructed in this example to express the aptamer ribozyme-modified sgRNA targeting the human GLRX3 gene regulated by theophylline is as follows:

[0059] Expressed sgRNA-AZ 2.0 backbone (skeleton structure shown in figure 1 (shown), the aptamer ribozyme P1-F5 is inserted at the tetraloop and stem loop 2 positions, wherein the sequence of the aptamer ribozyme P1-F5 is as follows:

[0060] GGCCCTGAGATGCAGGTACATCCAGCTGATGAGTCCCAAATAGGACGAAAGCCATACCAGCCGAAAGGCCCTTGGCAGGGTTCCTGGATTCCACTGCTATCCACGGCC.

[0061] The complete sequence of the sgRNA-AZ 2.0 backbone is:

[0062] GAATTCGGTCTC CGTTTTAGGCTA GGCCCTGAGATGCAGGTACATCCAGCTGATGAGTCCCAAATAGGACGAAAGC CATACCAGCCGAAAGGCCCTTGGCAGGGTTCCTGGATTCCACTGCTATCCACGGCC TAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTT GGCCCTGAGATGCAGGTACATCCAGCTGATGAGTCCCAAATAGGACGAAAGCCATACCAGCC GAAAGGCCCTTGGCAGGGTTCCTGGATTCCACTGCTATCCACGGCC AAGTGGCACCGAGTCGGTGCTTTTTT ACTAG T .

[0063] The U6 promoter sequence is as follows:

[0064] G...

Embodiment 2

[0082] The carrier constructed in this example to express the aptamer ribozyme-modified sgRNA targeting the human VEGFA gene and regulated by theophylline is as follows:

[0083] The sgRNA sequence targeting the human GLRX3 gene in Example 1 was replaced by the sgRNA sequence targeting the human VEGFA gene. The sgRNA sequence targeting the human VEGFA gene inserted in the two BsaIs is as follows:

[0084] GGTGAGTGAGTGTGTGCGTG.

[0085] Other structures of the carrier are the same as in Example 1.

[0086] In step 4 of the construction method, the method for constructing the pU6-sgRNA-AZ2.0-VEGFA vector targeting the human VEGFA gene is:

[0087] The sgRNA fragment targeting the human VEGFA gene is formed by annealing primers synthesized by Suzhou Jinweizhi Co., Ltd. The sequence is as follows (the underline indicates the cohesive end sequence):

[0088] P3: ACCG GGTGAGTGAGTGTGTGCGTG;

[0089] P4: AAAC CACGCACACACTCACTCACC.

[0090] The rest of the construction method ...

Embodiment 3

[0092] The carrier constructed in this example to express the aptamer ribozyme-modified sgRNA targeting the promoter of the human PGRN gene and regulated by theophylline is as follows:

[0093] The sgRNA sequence targeting the human GLRX3 gene in Example 1 was replaced by the sgRNA sequence targeting the promoter of the human PGRN gene. The sgRNA sequence targeting the promoter of human PGRN gene inserted in two BsaIs is as follows:

[0094] CGTCGGGACAGCTCTCAGCA.

[0095] The other structures of the carrier are the same as in Example 1.

[0096] In step 4 of its construction method, the method for constructing the pU6-sgRNA-AZ2.0-PGRN Pro vector targeting the human PGRN gene promoter is:

[0097] The sgRNA fragment targeting the promoter of the human PGRN gene is formed by annealing primers synthesized by Suzhou Jinweizhi Co., Ltd. The sequence is as follows (the underline indicates the cohesive end sequence):

[0098] P5: ACCG CGTCGGGACAGCCTCAGCA;

[0099] P6: AAAC TG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an aptazyme modified sgRNA carrier with theophylline regulated expression. Aptazyme P1-F5 is inserted to tetraloop and stem loop 2 positions of an expressed sgRNA-AZ 2.0 skeleton; by means of Kpn I and EcoR I sites, and EcoR I and Spe I sites, a U6 promoter and the sgRNA-AZ 2.0 skeleton are connected into the carrier pUC19 / EKSHL in order to obtain the carrier pU6-sgRNA-AZ 2.0; using Bsa I for enzyme digestion of the carrier pU6-sgRNA-AZ 2.0, and using cohesive end design and connecting an sgRNA sequence directing at the target gene so as to obtain the pU6-sgRNA-AZ 2.0-target site. The carrier can effectively mediate the genome editing function of Cas9 protein, and bring the editing activity under regulation of theophylline, also can mediate the transcription inhibition of dCas9-KRAB protein to the target gene, and enables regulation of inhibitory activity by theophylline.

Description

technical field [0001] The invention belongs to the field of biotechnology and relates to a carrier, in particular to a carrier expressing an aptamer ribozyme-modified sgRNA regulated by theophylline and an application thereof. Background technique [0002] Aptamer ribozyme (Aptazyme) aptamer ribozyme riboswitch is a kind of artificial gene regulation switch that appeared in recent years. The most common aptamer ribozyme consists of a hammerhead ribozyme and an aptamer, which has a clear structure and is easy to design. As a cis-acting element, under the action of a specific ligand, the aptamer ribozyme riboswitch can regulate the translation of mRNA by regulating its own shearing reaction without the assistance of protein molecules, and can be applied to the production of various cells. gene regulation. A reported aptamer ribozyme P1-F5 ( et al., 2010; Ketzer, et al., 2014) can undergo self-cleavage after binding with theophylline, resulting in cleavage and degradation ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/63C12N15/113C12N9/22
CPCC12N9/22C12N15/113C12N15/63C12N2320/50
Inventor夏海滨陈皓郑晓晶代鑫李燕陈芳
OwnerSHAANXI NORMAL UNIV