Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

High-activity sgRNA framework having two mutated basic groups, sgRNA framework carrier and application of sgRNA framework carrier

A backbone carrier and high-activity technology, applied in DNA/RNA fragments, stably introducing foreign DNA into chromosomes, recombinant DNA technology, etc., can solve the problem of affecting gene editing activity, reducing sgRNA scaffold transcription, and mediating Cas9 editing activity. And other issues

Inactive Publication Date: 2019-09-17
XI AN JIAOTONG UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the sgRNA scaffold sequence of Zhang Feng’s experimental group, in addition to 5 consecutive T bases at the end of the sequence, there are also 4 consecutive T bases at the start site of the sgRNA scaffold, that is, the repeat sequence of crRNA. The applicant speculates that this sequence will Affect the early termination of transcription, thereby reducing the transcription of sgRNA scaffold, which indirectly affects the gene editing activity of the Cas9 / sgRNA complex
In order to solve this problem, Zhang Feng’s team changed TTTT to TATT base, but it was identified by T7Endonuclease I digestion, and the results showed that the mutation hardly improved its editing activity mediated by Cas9 (HsuPD, et al., 2013)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-activity sgRNA framework having two mutated basic groups, sgRNA framework carrier and application of sgRNA framework carrier
  • High-activity sgRNA framework having two mutated basic groups, sgRNA framework carrier and application of sgRNA framework carrier
  • High-activity sgRNA framework having two mutated basic groups, sgRNA framework carrier and application of sgRNA framework carrier

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] The highly active sgRNA vector pU6-sgRNA(TTAT)-TPI1P2 constructed in this example expressing targeting human TPI1P2 gene is as follows:

[0050] In the highly active sgRNA (TTAT) scaffold, the continuous TTTT bases in the crRNA repeat sequence of the original backbone sequence are replaced with TTAT bases, and the continuous AAAA bases in the corresponding complementary trancRNA sequences are replaced with ATAA bases, that is, the original backbone sequence is changed. sgRNA backbone two bases ( figure 1 ). The highly active sgRNA (TTAT) scaffold fragment was synthesized by PCR:

[0051] The upstream primer sequence SEQ.ID.NO.2 is as follows:

[0052] GAATTC GGTCTCCG TTAT AGAGCTAGAAATAGCAAGTT ATAA TAAG GCTAGTCCGTTAT

[0053] The downstream primer sequence SEQ.ID.NO.3 is as follows:

[0054] T ACTAGT AAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATA ACGGACTAGCCTT

[0055] The complete sequence SEQ.ID.NO.1 of the sgRNA (TTAT) scaffold with the 5' end containing EcoRI a...

Embodiment 2

[0079] The highly active sgRNA vector pU6-sgRNA(TTAT)-EMX1 constructed in this example expressing targeting human EMX1 gene is as follows:

[0080] The sgRNA fragment targeting the human TPI1P2 gene in Example 1 was replaced by the sgRNA fragment targeting the human EMX1 gene. The sequence SEQ.ID.NO.6 of the sgRNA fragment targeting the human EMX1 gene inserted in the two BsaIs is as follows:

[0081] AGTCCGAGCAGAAGAAGAA.

[0082] The other structures of the carrier are the same as in Example 1.

[0083] In step 3 of its construction method, the method for constructing a pU6-sgRNA (TTAT)-EMX1 vector targeting the human EMX1 gene is:

[0084] The sgRNA fragment targeting the human EMX1 gene is formed by the annealing of primers, which are synthesized by Shanghai Shenggong Company, the upstream primer P5 is SEQ.ID.NO.11, and the downstream primer P6 is SEQ.ID.NO.12, the sequences are as follows (underlined). sticky end sequences):

[0085] P5: ACCG AGTCCGAGCAGAAGAAGAA;

...

Embodiment 3

[0089] The highly active sgRNA vector pU6-sgRNA (TTAT)-RANKL expressing targeting human RANKL gene constructed in this example is as follows:

[0090] The sgRNA fragment targeting the human TPI1P2 gene in Example 1 was replaced by the sgRNA fragment targeting the human RANKL gene. The sequence SEQ.ID.NO.7 of the sgRNA fragment targeting the human RANKL gene inserted in the two BsaIs is as follows:

[0091] GCTTCTTCTTCTTCTCTCT.

[0092] The other structures of the carrier are the same as in Example 1.

[0093] In step 3 of its construction method, the method for constructing a pU6-sgRNA (TTAT)-RANKL vector targeting human RANKL gene is:

[0094] The sgRNA fragment targeting human RANKL gene is formed by primer annealing, and the primers are synthesized by Shanghai Shenggong Company. The upstream primer P7 is SEQ.ID.NO.13, and the downstream primer P8 is SEQ.ID.NO.14. The sequence is as follows (underlined). sticky end sequences):

[0095] P7: ACCG GCTTCTTCTTCTTCTCTCT;

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a high-activity sgRNA framework having two mutated basic groups, a sgRNA framework carrier and an application of the sgRNA framework carrier. Based on a sgRNA scaffold carrier in a Zhangfeng laboratory, the sgRNA framework carrier is realized through changes of two basic groups of a sequence of a framework. A high-activity framework segment sgRNA(TTAT) scaffold obtained through PCR is connected to a carrier pUC19 / hU6-sgRNA through a EcoRI site and a SpeI site, sgRNA scaffold of an original carrier is replaced, and a high-activity sgRNA framework carrier pU6-sgRNA(TTAT)scaffold is obtained; and a BsaI enzyme cutting carrier pU6-sgRNA(TTAT)scaffold is used and connected to a sgRNA sequence in accordance with a target gene through a sticky end, and a carrier pU6-sgRNA(TTAT)-target site is obtained. The genome editing action of mediated Cas9 protein can be notably improved, and the effect of the sgRNA framework carrier is obviously better than that of wild sgRNA framework carrier.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a carrier, in particular to a double-base mutation high-activity sgRNA skeleton, a sgRNA skeleton carrier and applications thereof. Background technique [0002] The CRISPR / Cas9 system is a third-generation gene editing technology that relies on sgRNA to guide Cas9 nucleases to perform gene editing at specific positions. It is widely used in genome editing and plays an important role in agriculture, life sciences and medicine. The CRISPR / Cas9 system mainly includes two parts: (1) nuclease from Streptococcus (S. pyogenes Cas9 (SpCas9)); (2) Single guide RNA (sgRNA), the sgRNA expression vector contains a 20bp specific variable target site Dots and 82bp fixed sgRNA scaffold (sgRNA scaffold). The sgRNA backbone is a chimera of two RNA molecules (CRISPR RNA (crRNA), trans-activating CRISPR RNA (tracrRNA)) in the artificially constructed CRISPR target recognition system (Jinek, et al., 201...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/63C12N15/90
CPCC12N15/113C12N15/63C12N15/902C12N2310/10C12N2310/20
Inventor 陈皓陈欢欢胡维欣王卓馨杨铁林郭燕
Owner XI AN JIAOTONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com