High-activity sgRNA framework having two mutated basic groups, sgRNA framework carrier and application of sgRNA framework carrier
A backbone carrier and high-activity technology, applied in DNA/RNA fragments, stably introducing foreign DNA into chromosomes, recombinant DNA technology, etc., can solve the problem of affecting gene editing activity, reducing sgRNA scaffold transcription, and mediating Cas9 editing activity. And other issues
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] The highly active sgRNA vector pU6-sgRNA(TTAT)-TPI1P2 constructed in this example expressing targeting human TPI1P2 gene is as follows:
[0050] In the highly active sgRNA (TTAT) scaffold, the continuous TTTT bases in the crRNA repeat sequence of the original backbone sequence are replaced with TTAT bases, and the continuous AAAA bases in the corresponding complementary trancRNA sequences are replaced with ATAA bases, that is, the original backbone sequence is changed. sgRNA backbone two bases ( figure 1 ). The highly active sgRNA (TTAT) scaffold fragment was synthesized by PCR:
[0051] The upstream primer sequence SEQ.ID.NO.2 is as follows:
[0052] GAATTC GGTCTCCG TTAT AGAGCTAGAAATAGCAAGTT ATAA TAAG GCTAGTCCGTTAT
[0053] The downstream primer sequence SEQ.ID.NO.3 is as follows:
[0054] T ACTAGT AAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATA ACGGACTAGCCTT
[0055] The complete sequence SEQ.ID.NO.1 of the sgRNA (TTAT) scaffold with the 5' end containing EcoRI a...
Embodiment 2
[0079] The highly active sgRNA vector pU6-sgRNA(TTAT)-EMX1 constructed in this example expressing targeting human EMX1 gene is as follows:
[0080] The sgRNA fragment targeting the human TPI1P2 gene in Example 1 was replaced by the sgRNA fragment targeting the human EMX1 gene. The sequence SEQ.ID.NO.6 of the sgRNA fragment targeting the human EMX1 gene inserted in the two BsaIs is as follows:
[0081] AGTCCGAGCAGAAGAAGAA.
[0082] The other structures of the carrier are the same as in Example 1.
[0083] In step 3 of its construction method, the method for constructing a pU6-sgRNA (TTAT)-EMX1 vector targeting the human EMX1 gene is:
[0084] The sgRNA fragment targeting the human EMX1 gene is formed by the annealing of primers, which are synthesized by Shanghai Shenggong Company, the upstream primer P5 is SEQ.ID.NO.11, and the downstream primer P6 is SEQ.ID.NO.12, the sequences are as follows (underlined). sticky end sequences):
[0085] P5: ACCG AGTCCGAGCAGAAGAAGAA;
...
Embodiment 3
[0089] The highly active sgRNA vector pU6-sgRNA (TTAT)-RANKL expressing targeting human RANKL gene constructed in this example is as follows:
[0090] The sgRNA fragment targeting the human TPI1P2 gene in Example 1 was replaced by the sgRNA fragment targeting the human RANKL gene. The sequence SEQ.ID.NO.7 of the sgRNA fragment targeting the human RANKL gene inserted in the two BsaIs is as follows:
[0091] GCTTCTTCTTCTTCTCTCT.
[0092] The other structures of the carrier are the same as in Example 1.
[0093] In step 3 of its construction method, the method for constructing a pU6-sgRNA (TTAT)-RANKL vector targeting human RANKL gene is:
[0094] The sgRNA fragment targeting human RANKL gene is formed by primer annealing, and the primers are synthesized by Shanghai Shenggong Company. The upstream primer P7 is SEQ.ID.NO.13, and the downstream primer P8 is SEQ.ID.NO.14. The sequence is as follows (underlined). sticky end sequences):
[0095] P7: ACCG GCTTCTTCTTCTTCTCTCT;
...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


