Unlock instant, AI-driven research and patent intelligence for your innovation.

A pesticide composition and a preparing method thereof

A composition and insecticide technology, applied in the field of insecticide composition and its preparation, can solve the problems of beneficial organisms, slow degradation speed, non-target biological damage, etc., achieve good environmental compatibility, avoid resistance, The effect of easy operation

Inactive Publication Date: 2018-05-15
杭州更蓝生物科技有限公司
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, chemical pesticides are one of the effective means to prevent and control pests, but the use of chemical pesticides is a double-edged sword, and the following problems will be accompanied by good results: 1) chemical pesticides do not have Target selectivity, when chemical insecticides are applied to control harmful insects, they also cause damage to non-target organisms, some of which are beneficial
2) On the soil where chemical pesticides are applied, it usually shows a barren state for a corresponding period of time
3) Chemical pesticides continue to remain in the environment and degrade slowly, resulting in residues of chemical pesticides in crops and the environment, which will accumulate in the food chain, with humans bearing the brunt as the top of the food chain. The accumulation of these chemical pesticides lead to the induction of various diseases, such as cancer
First, the antisense sequences expressed in transformed cells are unstable
Second, the instability of the antisense sequence expressed in transformed cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A pesticide composition and a preparing method thereof
  • A pesticide composition and a preparing method thereof
  • A pesticide composition and a preparing method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Embodiment 1, determination of target sequence

[0029] Step 1. Extracting the total RNA of Thrips occidentalis: extract the RNA of the larvae of Thrips occidentalis by conventional Trizol method, purify by conventional methods, and treat with DNase to obtain concentration ≥ 280ng / μl, total amount ≥ 10μg, OD 260 / 280 1.9-2.1 for total RNA samples.

[0030] Step 2. Isolate mRNA and synthesize cDNA: use oligo-dT magnetic beads to isolate mRNA with polyA, and then use random hexamers and Invitrogen kits to synthesize the first strand of cDNA.

[0031] Step 3: Screen out the target sequence, compare with NCBI, and screen out 6 target sequences of Thrips occidentalis from various metabolic pathways through research and analysis. The corresponding GENBANK accession number is: GT301184, GenBank: GT308845.1 Specific information As follows:

[0032] Target sequence 1: GTTACGCTAACGGTCAAATG (SEQ ID NO: 1)

[0033] Target sequence 2: AATGCCTCCTGATTTTGCCAAT (SEQ ID NO: 2)

[0034...

Embodiment 2

[0038] Embodiment 2, the construction of plant expression vector

[0039]According to tomato Ubi promoter-target sequence sense strand-spacer sequence-target sequence antisense strand are connected together, and form expression vector with marker gene Hpt. The sense primers have EcoR I and Hind III restriction sites at both ends, the antisense primers have Xho I and Sac I restriction sites at both ends, and the spacer primers have Hind III and Sac I restriction sites at both ends point. The recombinant cloning vector containing the sense strand was double-digested, and the sense strand fragment was recovered. The recombinant expression vector XHJM was subjected to the same double digestion to recover the linearized plasmid, and ligated with the target fragment to obtain the recombinant expression vector XHJM-X1. The recombinant expression vector XHJM-X1 was double digested, and the linearized plasmid was recovered. The recombinant cloning vector containing the antisense str...

Embodiment 3

[0041] Embodiment 3, obtaining transgenic tomato

[0042] The correct recombinant expression vectors XHJM-01, XHJM-02, XHJM-03, XHJM-04, XHJM-05 and XHJM-06 were transformed into Agrobacterium EHA105 (Invitrgen, Chicago, USA, CAT: 18313-015), according to the commonly used Agrobacterium infection method, the tomato seedlings cultured aseptically were co-cultured with the Agrobacterium described in the third embodiment, so that the recombinant expression vector XHJM- 01, T-DNA in XHJM-02, XHJM-03, XHJM-04, XHJM-05 and XHJM-06 (including X1 nucleotide sequence, X2 nucleotide sequence, X3 nucleotide sequence, X4 nucleotide sequence sequence, X5 nucleotide sequence, X6 nucleotide sequence, maize Ubi promoter sequence, Hpt gene and Nos terminator sequence) were transferred into the tomato genome, and tomato plants and transgenic plants with X1 nucleotide sequence were obtained. Tomato plant with X2 nucleotide sequence and tomato plant with X3 nucleotide sequence, tomato plant with...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of pesticides, and particularly relates to a pesticide composition and a preparing method thereof. The pesticide composition includes polynucleotide sequences shownas SEQ ID NO:2, 4, and 5; or polynucleotide sequences hybridized with the set polynucleotide sequences under strict conditions; or polynucleotide sequences having 80% or above of identity with the setpolynucleotide sequences; or polynucleotide sequences comprising at least 19 continuous nucleotides in the set polynucleotide sequences. Thysanoptera pests take in double-stranded RNAs comprising atleast one chain complementary with the polynucleotide sequences, and growth of the thysanoptera pests is inhibited.

Description

technical field [0001] The invention relates to an insecticide composition and a preparation method thereof, in particular to a method for inhibiting pest damage of Western flower thrips by using RNAi technology to down-regulate or hinder the expression of target sequences in Western flower thrips. Background technique [0002] For the pest disasters in agricultural production, researchers have successfully developed some methods and compositions. Among them, chemical pesticides are one of the effective means to prevent and control pests, but the use of chemical pesticides is a double-edged sword, and the following problems can be accompanied when good results are obtained: 1) chemical pesticides do not have Target selectivity, the application of chemical insecticides to control pest insects can also cause damage to non-target organisms, including beneficial organisms. 2) On the soil where chemical pesticides are applied, it usually shows a barren state for a corresponding ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A01N43/08A01P7/04
CPCA01N43/08
Inventor 董秋月
Owner 杭州更蓝生物科技有限公司