Identification of fetal DNA and fetal cell markers in maternal plasma or serum

a technology of fetal cell markers and dna, which is applied in the field of identification of fetal specific nucleic acids and fetal cell markers, can solve the problems of not being able to measure the dna of female fetuses, and expose both the mother and the fetus to a certain amount of risk

Inactive Publication Date: 2013-07-04
GENETIC TECHNOLOGIES LIMTIED
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

Enables non-invasive, gender-independent quantification of fetal DNA and isolation of fetal cells, reducing risks associated with invasive procedures and providing a more accurate means of diagnosing fetal abnormalities like trisomy 21.

Problems solved by technology

However, as both amniocentesis and chorionic villus sampling require invasive procedures for obtaining fetal cells, they inevitably expose both the mother and the fetus to a certain amount of risk.
Thus far, the quantitation of fetal DNA has generally relied upon Y-chromosome-specific sequences, which cannot serve to measure the DNA of female fetuses.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Identification of fetal DNA and fetal cell markers in maternal plasma or serum
  • Identification of fetal DNA and fetal cell markers in maternal plasma or serum

Examples

Experimental program
Comparison scheme
Effect test

example 1

Materials and Methods

[0197]Isolation of DNA from Plasma

Preparation of Cell-Free Plasma from Whole Blood[0198]1. Centrifuge whole blood at 1000×g for 10 minutes[0199]2. Allow cells to settle for a further 10 minutes[0200]3. Remove plasma phase with a pipette[0201]4. Re-centrifuge the plasma phase at 1600×g for 10 minutes[0202]5. Aliquot plasma into 1.5 ml Eppendorf tubes[0203]6. Centrifuge at 16000×g for 5 minutes[0204]7. Transfer cleared plasma to a clean tube for DNA extraction or storage.

DNA extraction

[0205]Genomic DNA was extracted from 200 μl of plasma using the Qiagen QIAmp DNA Blood minikit, following the Blood and Body Fluids protocol with the following modifications. The DNA solution was passed through a single column four (4) consecutive times before the wash steps. DNA was eluted from the column using 65 μl of warm (56° C.) 1× PCR buffer (Invitrogen). The eluate was re-loaded onto the column for a second elution. Multiple extractions (200 μl per column) from the same plasm...

example 2

Prophetic

[0256]A lymphocyte preparation is obtained form a pregnant female and HLA typed using HLA serological typing trays obtained from Pel-Freez Clinical Systems, LLC (Wisconsin, USA).

[0257]A list of HLA alleles which the mother does not possess is prepared. Preferably, the list is ordered to ensure that the more common HLA alleles are tested first. This will reduce costs, as less HLA alleles should need to be screened before a HLA antigen specific to the fetal cells is identified.

[0258]A maternal plasma sample comprising fetal DNA is prepared as outlined in WO 98 / 39474. The sample comprising fetal DNA is HLA typed for alleles not present in the mother using multiple sets of PCR primers designed to amplify specific HLA alleles followed by the detection of amplification products. Positive reactions (amplification products) will identify HLA alleles present in the fetal DNA but absent in the maternal DNA which can be used as fetal DNA / cell markers.

[0259]If commercial SSP kits are u...

example 3

Prophetic

Fetal DNA Quantitation Procedure Using HLA Type-Specific Standard Curve

[0260]Stocks of HLA-type specific DNA samples are prepared from genomic DNA of blood donors, and their exact DNA quantity is determined by standard (spectrophotometric or chemical) methods. The stocks are stored as single-use aliquots.

[0261]In the instance where fetal HLA typing from maternal plasma using a method of the invention has revealed HLA-A29 to be a unique fetal allele of the fetus a 1:3 dilution series from a stored aliquot of HLA-A29 standard DNA is made, covering a range from 5 ng to 1 pg DNA (=standard curve). A PCR primer pair is chosen that is specific for HLA-A29, for example; Forward CCCACTCCATGAGGTATTTCA (SEQ ID NO:13) and Reverse CTCCTGCTCTATCCACGGT (SEQ ID NO:14). Real-time quantitative PCR reactions are set up, using the standard curve preparation as well as 3-5 replicates of an aliquot (5-40 ul) of the DNA prepared from the maternal plasma (=test samples).

[0262]Reactions are carrie...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to the identification of fetal specific nucleic acids and fetal cell markers in maternal plasma or serum. In particular, the present invention relates to methods which rely on the analysis of polymorphic alleles of a population to determine an allele which is possessed by the fetus but absent from the mother. Fetal specific alleles identified using the methods of the invention can be used to quantify fetal DNA from maternal plasma or serum. In addition, antigens encoded by alleles identified using the methods of the invention can be targeted in methods of isolating or detecting fetal cells.

Description

FIELD OF THE INVENTION[0001]The present invention relates to the identification of fetal specific nucleic acids and fetal cell markers. In particular, the present invention relates to the identification of alleles of fetal DNA which are not present in the genome of the mother. Fetal specific alleles identified using the methods of the invention can be used to quantify fetal DNA in a sample comprising fetal and maternal nucleic acids. In addition, antigens encoded by alleles identified using the methods of the invention can be targeted in methods of isolating or detecting fetal cells.BACKGROUND OF THE INVENTION[0002]Currently, fetal diagnosis is generally carried out by a procedure known as amniocentesis which involves the aspiration of a small sample of amniotic fluid from the pregnant mother, culturing the fetal cells in the fluid, and determining the karyotype of the fetal cells. Recently, chorionic villus sampling has also been used, which involves the direct transcervical and tr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12Q1/68G01N33/50G01N33/569
CPCC12Q1/6858C12Q1/6881G01N33/5044C12Q1/68G01N33/5094G01N33/56977G01N33/5091C12Q2600/156C12Q2600/16
InventorBOHMER, RALPH MICHAEL
OwnerGENETIC TECHNOLOGIES LIMTIED