94 results about "Etiolation" patented technology

The invention discloses a light guide plate engraved by laser pulse, which comprises a reflective layer made of high reflective non-light-absorptive materials, a light guide layer made of high light transmittance materials and a diffusion layer made of light uniform scattering materials. The light guide plate is characterized in that reflecting diffusion sites or diffusion grooves engraved by laser pulse are distributed on the light guide layer of the light guide plate, spacing among the reflecting diffusion sites or diffusion grooves is smaller than or equal to 5mm, the depth of the reflecting diffusion sites or diffusion grooves under control of laser energy ranges from 0.001mm to 1mm, and the diameter of the diffusion sites ranges from 0.005mm to 2mm. In addition, the invention further discloses a method for preparing the light guide plate. The light guide plate manufactured by the method has the advantages of ultra-thinness, super-brightness, uniform light scattering, saving energy, environmental protection, durability, etiolation resistance, fast and simple installation and maintenance and the like without dark spaces.

The invention discloses a modulus bamboo cellulose fiber with high strength and high humidity and a preparation method thereof. With cellulose bamboo pulp as the raw material, the fiber is prepared through steps of impregnation alkalization, press grinding, being well versed, etiolation, dissolution, ripening, filtration, deaeration, wet spinning solidification molding, drafting, plasticization, post processing, etc. The fiber dry state fracture strength is 2.50-5.00CN / dte, the wet state fracture strength is 1.30-3.5CN / dtex and the wet modulus is 0.28-0.55CN / dtex. The invention overcomes the defects of the easy deformation, the poor size stability and no alkali resistance of the present bamboo cellulose fiber under the wet state and has the advantages of uneasy deformed textile, good size stability, good alkali resistance, etc. under the wet state. And the good characteristics of natural bamboo fiber are maintained in the invention, including coolness, air previous property, moisture absorption, bacteriostasis, etc. the more important is that the invention is provided with higher strength and good application property.

The invention discloses a summer black grape plantation method, and the method comprises the steps of cutting seedlings cultivation, garden building, soil working, planting, vine and leaf management, cluster management, fertilizer and water management and insect disease control. The method particularly comprises the steps of alleviating basal blade etiolation by cutting shoot pinching in 8+3+3 leaf mode; and benefiting middle-and-bottom knot bud differentiation. The leaf photosynthesis has 3 peak periods; the leaves over 8 and the auxiliary shooter leaves are mainly used to supply photosynthetic nutrition for the fruit at the second expansion period, benefiting the fruit in expansion and increasing sugar; 5 bud middle shooter is trimmed in winter to reduce branch and bud amount, and to reduce buds wiping and shooter wiping amount in the next year correspondingly. Digital management is adopted in the whole process, so that a worker can operate easily; in the grape growth process after application, work required in each phase can be done regularly; standard systematic management to the growth of the summer black grape can guarantee the quality of the summer black grape.

The invention discloses a method for preparation of viscose fiber using sweet sorghum stalk. The cellulose pulp of sweet sorghum stalk is made by using sweet sorghum stalk as raw material. The viscose fiber is produced by cellulose pulp of sweet sorghum stalk. The steps of preparing viscose fiber using sweet sorghum stalk are as follow: stock, cooking, discharge, dressing by washing, desanding, chlorination, basification, bleeching by sodium hypochlorite, washing, condensing, paper making, dipping, compression, aging, etiolation, grinding, dissolution, blending, filtrating, debubbling, filtrating, spinning, drafting, post-processing and etc. The invention can effectively removed the impurities in the sweet sorghum stalk, therefore a high-quality viscose fiber of sweet sorghum stalk is obtained, with high cellulose content, good whiteness, lower impurity contents of pentose, crozzle and so on.

The invention provides a medium trace element compound fertilizer containing vitamin B.The medium trace element compound fertilizer is characterized by at least being prepared from, by weight, 0.1-2 parts of EDTA chelated copper, 3-10 parts of EDTA chelated zinc, 1-7 parts of EDTA chelated iron, 1-6 parts of EDTA chelated manganese, 1-5 parts of EDTA chelated magnesium, 2-8 parts of sodium borate, 2-10 parts of vitamin B, 1-20 parts of diethylaminoethyl hexanoate DA-6 and 3-12 parts of modified chitooligosaccharide.The medium trace element compound fertilizer containing vitamin B has high cold resisting and disease resisting capability, has a significant effect on etiolation caused by medium trace element deficiency of plants and can increase the nutritional ingredients and yield of crops; besides, according to a preparation method of the fertilizer, operation is easy, and the operation environment is safe.

The invention involves a method to produce mucilage glue long-thread by using hemp plasm. It contains: plasm dipping, squeezing, crushing, full growth, etiolation, after-dissolving blending, filtering, baking, becoming canister, twisting, and packing. The source of the material is abundant and the production feels silken and seems colorful. It can replace natural silk and provides an approach of using hemp properly. At the same time, it remians the natural hemp of crude anti-bacterium, and empolder a a new applied realm of mucilage glue long-thread.

The present invention discloses a cutting method for tea seedlings. The method comprises six main steps of scion cutting, seedbed preparation, scion inserting, greenhouse shading cultivation, greenhouse cultivation, nutritional bowl loading in a sucker division mode and seedling-hardening. During a process of seedbed preparation, by adding water-absorbing resin into mixed subsoil, the heavy workload for water management after cutting in a traditional scion cutting is reduced by using an excellent characteristic of a strong water retention property of the water-absorbing resin. The cut seedbed is fed into a shading greenhouse; by leaf and organization etiolation, a cortex of the scion is thickened and parenchymal cells are increased to promote differentiation and rooting of an original body of a scion root. In addition, the temperature of a cutting soil layer is controlled to be maintained at 30 DEG C within 50 days all the way, so that the scions are quick to take roots, thereby improving the survival rate of the cutting seedlings. Practice indicates that by adopting the method disclosed by the present invention, the survival rate of the cutting seedlings reaches up to 98%. Compared with that of a traditional method, 15% is increased. In conclusion, the method disclosed by the present invention has the advantages of simple operation and rapid rooting speed; the method is not limited by seasons and can meet the demand for actual production.

The invention relates to an optical diffuser plate for use in a liquid crystal device, comprising a layer composite structure which at least consists of one substrate layer and side layers, wherein each side layer comprises two layers; the substrate is clipped in the side layer; the substrate layer adopts polystyrene (PS) as a base material and is combined with optical diffusant to form a blending layer; and the side layers all adopt a blending layer which takes the polystyrene (PS) as the base material to be combined with the optical diffusant and benzotriazole ultraviolet absorbent. Through adopting the polystyrene (PS) as the base material, the diffuser plate has higher light transmittance; meanwhile, the polystyrene has low water absorbing capability, little effect to the deformation caused by ambient humidity change, so that the diffuser plate has excellent size stability. The structure ensures that the optical diffuser has excellent light transmittance and light distribution uniformity; and at the same time, the diffuser plate has the excellent size stability, thereby reducing etiolation of the base material caused by irradiation of ultraviolet rays, prolonging service life and greatly reducing production and manufacturing cost.

An efficient cultivation method of a turbot family offspring comprises the following steps: parent fish selection, parent fish cultivation, artificial directional mating, hatching, offspring cultivation and getting of commercial offsprings. The parent fish is selected from germplasm parent fish of different batches from different countries; artificial fertilization is performed among different germplasm parent fish, and the same batch of the parent fish are not allowed to mate with each other; offspring cultivation is as follows: at the early period, the adopted facility is a 3m glass reinforced plastics barrel, and bait comprises chlorella, rotifer and artemia; at the middle period, the adopted facility is a 10m cement pond, and the bait is micro pellet bait; at the later period, the adopted facility is a 20-30m cement pond, and the bait is fish larvae pellet bait; and specification of the commercial offsprings is 5-6cm. The method is characterized by adopting the parent fish with different germplasm resources for the artificial directional mating, and seriously controlling inbreeding; and adopting different culturing facilities to cultivate the offspring by three stages, which causes the offspring emergence rate of the commercial offspring to reach 46.8%, and improves growth rate thereof by 36%, and lowers of etiolation rate thereof below 5%. The method can efficiently produce high-quality turbot offsprings, and is applicable to large-scale production.

The invention provides a method for effectively preventing fruit trees iron deficiency yellowtop, which comprises steps: high concentration leaf fertilizers are sprayed in a spring sleep late, and the high concentration leaf fertilizers are sprayed in a mature period of blades for the first time. The method for effectively preventing the fruit trees iron deficiency yellowtop prevents fruit tree yellowtop from happening by spraying different formulas of high concentration leaf fertilizers according to different radios of required iron elements of fruit trees in development stages of the fruit trees from a spring dormant period of the fruit trees, a blade mature period to a senescence phase. The method for effectively preventing the fruit trees iron deficiency yellowtop is obvious in effects, obviously reduces occurrence rate of fruit trees yellowtop, enables the fruit trees in a 0-level etiolation degree to achieve 96-97% total amount of the fruit trees, and is obvious in the prevention effect of the fruit trees yellowtop in saline areas.

The invention discloses a storage and preservation method of flowering Chinese cabbage. The method comprises the following steps of 1) selecting out flowering Chinese cabbage which is harvested in a suitable stage and has not mechanical damages, diseases and insect damages, precooling, and treating cuts of the precooled flowering Chinese cabbage through an anti-bacterial agent and an anti-browning agent, 2) filling the flowering Chinese cabbage treated by the previous step into preservation bags, treating the flowering Chinese cabbage through 1-methylcyclopropene solution with a concentrationof 0.5 to 30 ppm, tying up the preservation bags immediately, and storing them at a temperature of 1 to 2 DEG C, wherein during the storage process, the preservation bags are closed for at least 12 hours. In the invention, flowering Chinese cabbage is precooled, treated by an anti-decay and anti-browning process, packaged by preservation bags, and through a combination with biological characteristics, treated through an ethylene action inhibitor 1-methylcyclopropene with an appropriate concentration at a low temperature. Therefore, senescence symptoms of flowering Chinese cabbage blade etiolation, tender stem lignification and the like are slowed down; and symptoms of decay, cut browning and wilting due to water loss are reduced. The storage and preservation method is utilized for treating fresh flowering Chinese cabbage and treated flowering Chinese cabbage still keeps the original quality after one mouths.

The invention relates to an etiolation resisting agent for fresh-cut eleocharis tuberosa. The etiolation resisting agent comprises 0.5%-1.0% of salicylic acid , 1.0%-1.5% of ferulic acid, 0.2%-2.0% of a fresh ginger extract, 0.5%-1.0% of chitosan and the balance of water. An application method of the etiolation resisting agent for fresh-cut eleocharis-tuberosa comprises the following steps of (1) peeling eleocharis tuberosa, and cutting the peeled eleocharis tuberosa into sheets of which the thickness is 0.4-0.6cm; (2) soaking the fresh-cut eleocharis tuberosa with the etiolation resisting preparation for the fresh-cut eleocharis tuberosa for 10-20min; (3) performing drying to remove the moisture on the surface of the fresh-cut eleocharis tuberosa; and (4) performing sealed packaging with a preservative film so as to obtain finished products of the etiolation resisting preparation for fresh-cut eleocharis tuberosa. The etiolation resisting agent disclosed by the invention can maintain the bright and white color of the fresh-cut eleocharis tuberosa for 20 days or above, has the effect of fresh keeping, and can effectively restrain the condition that the fresh-cut eleocharis tuberosa becomes rotten caused by pathogenic bacteria. The fresh keeping agent disclosed by the invention is low in cost, and the flavor of the eleocharis tuberosa is not influenced basically.

This invention relates to seedlings which demonstrate better emergence characteristics when grown in darkness and improved seedling growth when grown under low-light levels. More specifically, the present invention relates to producing plant cells and whole plants which contain a nucleic acid sequence coding for the Coil domain as well as the sequence coding for the wildtype COP1 gene. The plants of this invention display unopened, compact leaves during seedling emergence in the darkness and reduced etiolation of seedings grown in low-levels after emergence. The invention further relates to plant breeding methods which enable the transfer of these desirable traits to wildtype plants.

The invention discloses a special biological fertilizer for camphor tree etiolation treatment, and an application method thereof. The special biological fertilizer comprises 70-79wt% of a base fertilizer, 0.03-0.08wt% of chelated iron, 10-20wt% of an iron sulfate fertilizer, 3-8wt% of urea and 3-8wt% of a calcium magnesium phosphate fertilizer. The fertilizer has an obvious treatment effect on etiolation of camphor tree, and reduces the yellowed leaf rate of camphor to below 5% from original about 90%.

The invention discloses a special compound fertilizer for relieving citrus etiolation and a preparation method thereof. The special compound fertilizer for relieving citrus etiolation is prepared from, by weight, 40-70 parts of organic fertilizer, 20-35 parts of plant ash, 10-25 parts of inorganic fertilizer, 0.1-0.5 part of rooting agent, 3-5 parts of humate and 2-5 parts of bacterial manure; the bacterial manure comprises bacillus mucilaginosus, trichoderma harzianum and saccharomycetes; the compound fertilizer can provide various nutrient elements required by the growth of citrus and can also improve the soil environment, reproduction of harmful bacteria is inhibited, the growth of beneficial bacteria is promoted, the compound fertilizer helps diseased or infected plants to absorb the nutrient elements, then citrus etiolation diseases are relived, and the recovery of the citrus diseased or infected plants is promoted.

The invention belongs to the field of a plant cultivation medium, in particular to the technical field of an asplenium nidus cultivation medium. The asplenium nidus cultivation medium is characterized in that coconut sugar, peat soil and vermiculite are mixed evenly in the proportion of 4:2:1 to prepare the cultivation medium. The leaves of the asplenium nidus planted by the invention grow normally without etiolation and chlorosis, thereby improving the ornamental value of the asplenium nidus.

The invention discloses a molecular marker method of cucumber spire etiolation gene linking, belonging to the biotechnical field. A molecular marker SSR63 closely linked to the cucumber spire etiolation gene is disclosed for the first time, the forward and reverse primers of the marker are respectively: 5'GCTTCATCCTGTGGCGT3' and 5'CCAGTCATGGGTTTGTTGGA3'. In F2 constructed from spire cucumbers and green-leaf cucumbers, 226bp products can be amplified from the primers SSR63F / SSR63R inspire etiolation strain, 204bp product or product containing both 204bp and 226bp strips can be amplified in green-leaf strain, and all the products can be closely linked with vyl. The molecular marker closely linked with cucumber spire etiolation gene vyl can be used for cucumber spire etiolation gene mapping or molecular marker-assisted breeding.

The invention relates to the field of storing and keeping food fresh, and aims to provide a novel composite fresh keeping agent for keeping vegetables green. The novel composite fresh keeping agent for keeping the vegetables green is liquid and comprises the following effective components of cholesterol of 0.2-0.5g / L, L-arginine of 0.04-0.06mmol / L and water-soluble chitosan of 0.08-0.12%(m / m). According to the novel composite fresh keeping agent, the L-arginine and the cholesterol are matched for use, so that the fresh keeping effect of the cholesterol is enhanced; the dosage of the cholesterol contained in the novel composite fresh keeping agent is limited, and the novel composite fresh keeping agent is safe to use. The water-soluble chitosan is used as a preservative and a stabilizing agent for a cholesterol solution, and three kinds of ingredients are mixed in a specific proportion and certain sequence so as to obtain the composite fresh keeping agent. In the process of storing the picked vegetables, in a manner that the composite fresh keeping agent is absorbed through notches (or the picked vegetables are soaked in the composite fresh keeping agent before storage), the etiolation of the vegetables can be restrained, the lignification of the vegetables is delayed, the dehydration of the vegetables at the later stage is reduced, the exterior quality of the vegetables is maintained, the decomposition of the vegetables is restrained, and the storage period or the shelf life of the vegetables is significantly prolonged.

The invention discloses a method for promoting cutting rooting and seedling formation of tender branches of xanthoceras sorbifolium, and belongs to the technical field of forestry biology. The methodcomprises the following steps: in spring, excellent germplasm of the xanthoceras sorbifolium is selected, branches are cut, whole plants are covered by bags for shielding light, etiolation tender branches are collected 70 days, 80 days and 90 days after etiolation treatment is performed, the tender branches are pruned to tender branch cuttings, wherein each tender branch cutting is about 7-10 cm,the cuttings are processed by using indoleacetic acid with different concentrations, cutting is performed, cuttings are normally managed in a full-illumination spray cutting bed for rooting, 90 days after the cutting is performed, a rooting rate is counted, 110 days after the cutting is performed, growth period prolonging treatment is performed by using a simplified greenhouse on the cutting bed,and 280 days after the cutting is performed, a seedling forming rate is counted. According to the method disclosed by the invention, the etiolation treatment is performed for 80 days, the indoleaceticacid with a high concentration of 5000 mg / L is used for treatment, and cutting management is performed under the full-illumination spray conditions, so that the rooting rate and seedling forming rateof the tender branches of the xanthoceras sorbifolium are greatly improved; and the method for promoting the cutting rooting and seedling formation of the tender branches of the xanthoceras sorbifolium provided by the invention provide a technical basis for excellent seedlings of vegetative propagation much required by large-scale planting of a xanthoceras sorbifolium forest in China.

The invention relates to a pesticide composition for preventing and treating crop root nematodosis by foliage spray. The pesticide composition comprises effective components including oxamyl and a plant resistance inducer, wherein the plant resistance inducer is a plant growth regulator with a resistance induction effect or any one or a mixture of two of active polysaccharides; the plant growth regulator comprises compound nitrophenolate and diethyl aminoethyl hexanoate; the active polysaccharides comprise chitosan oligosaccharide and glucal; the effective components comprise 0.05-90.0 parts by weight of the oxamyl and 0.05-90.0 parts by weight of the plant resistance inducer. According to the pesticide composition, the synergistic effects of nematode killing and resistance induction are utilized to control the generation and the development of the crop root nematodosis; the pesticide composition is conducted to crop roots by foliage absorption and nematodes are prevented from being invaded, parasitized and reproduced at the roots; meanwhile, damages to crops by toxic secreta of the nematodes are removed and the symptoms of etiolation, withering and the like are relieved; the formation of insect galls at the roots is relieved. The pesticide composition has an obvious preventing and treating effect on systemic translocation insects and leaf diseases of over-ground parts of the crops.

The invention relates to a method for identifying wheat spring frost resistance with a movable solar greenhouse, the aims of which are that selected parameters are consistent, and results are more accurate. The method comprises the following steps: firstly establishing one or more mobile solar greenhouses; mounting movable greenhouse sliding tracks on the ground on the two sides at the bottom of the solar greenhouse; sowing to-be-identified materials on time according to the local field seeding management; sowing two sets of materials simultaneously; after wheat is overwintered, before the jointing period around March 5th, performing solar greenhouse coverage temperature rise on one of the materials to promote the growth and the development of the material and then performing low-temperature stress treatment around April 1st to stop the covering heat preservation; during the solar greenhouse temperature rise of the material, properly removing the solar greenhouse at noon on a sunny andwindless day so as to prevent the etiolation of material seedlings and performing solar radiation to prevent high temperature in the solar greenhouse and insufficient light from forming the etiolatedseedlings; after the frost damage treatment of the material, recording the frost damage of the different materials by leaf frost damage.

The invention discloses a flaky flat viscose fiber and a preparation method thereof. The preparation method comprises the following steps of: (1) adding a carbonate solution in a viscose solution which finishes etiolation, uniformly mixing with the viscose solution so as to obtain a blend spinning viscose glue, wherein the addition of carbonate is 30-50wt% of armour fiber in a cellulose viscose glue; (2) shaping the blend spinning viscose glue through coagulating bath spinning; and (3) carrying out spray guide drafting on the nascent fiber after shaping, wherein the drafting rate of the spray guide drafting is 30-60%, and the flaky flat viscose fiber is prepared through plastication drafting and postprocessing steps. According to the invention, the copying of the flat viscose fiber can be realized without a spinneret plate in a special jet orifice shape, the traditional production mode of the flat viscose fiber is broken, and the flaky flat viscose fiber is a primary revolution of manufacturing heterotypic viscose fiber. Compared with the prior art, the equipment investment is reduced, and the commercial process is easy to realize.

A fluorescent layer, its preparation method and uses are provided. The fluorescent layer is provided from a fluorescent material and a calcining material. The fluorescent material is in an amount ranging from about 5 wt % to about 95 wt % based on the total weight of the fluorescent layer. The fluorescent layer of the present invention can be used in a light-emitting diode to change the color of emitting-light and improve the heat dissipation of the light-emitting diode. Furthermore, the fluorescent layer of the present invention is free of an organic resin, and thus, does not have the problem of aging (etiolation). The final product has a stable, lasting and durable luminescent quality.

The invention relates to a diffusion plate for a backlight source of a liquid crystal display. A laminated composite structure at least consists of a substrate layer and a lateral layer, wherein the lateral layer has two layers, and the substrate layer is clamped between the two layers; the substrate layer is a blending layer which adopts polystyrene as a base material to be combined with a light diffusion agent; and the lateral layer is a blending layer which uses a transparent base material containing polyester, the light diffusion agent and a benzotriazole ultraviolet absorbent. As PS is adopted as the base material, the diffusion plate has higher light transmission rate; the PS has small water absorption rate, and has small deformation due to changes of environment humidity, so that the diffusion plate has excellent dimension stability; and furthermore, the lateral layer adopts the blending layer, etiolation caused by ultraviolet radiation can be reduced, and the service life of the diffusion plate can be prolonged.

The invention discloses a navel orange nutritional deficiency etiolation correcting multivariant leaf fertilizer, which comprises the following components according to the parts by weight: 140-200 parts of magnesium nitrate, 10-16 parts of sodium pyroborate, 8-12 parts of zinc sulfate, and 12-18 parts of dodecyl benzene. The invention also provides a preparation method and a use method for the navel orange nutritional deficiency etiolation correcting multivariant leaf fertilizer. The product can simultaneously correct the magnesium deficiency, boron deficiency and zinc deficiency of the navel orange in red area, solves the problems of magnesium fertilizer, boron fertilizer and zinc fertilizer needing to be respectively applied in the past, contains nutrient elements of nitrogen and sulfur, and can partly supplement the nitrogen and sulfur nutrition of the navel orange.

A light-emitting package structure is provided, including an encapsulant, an light-emitting component embedded the encapsulant and having a light-emitting side and a non-emitting side opposing the light-emitting side, a dam embedded and exposed from the encapsulant, and a phosphor layer covering the light-emitting side and the dam. The non-emitting side has a plurality of electrodes. Since the heat generated by the phosphor layer can be transmitted to an outside region of the light-emitting package structure through the dam, the etiolation of the encapsulant can thus be prevented. A method of fabricating the light-emitting package structure is also provided.

The invention discloses a viscose filament and its process for preparing, and the producing step mainly includes feed preparation, boiling, materials-washing, beating, riffling, bleaching, rinshing, riffling, compression, lifting, paste-dipping, pressing, comminuting, aging, etiolation, dissolution, mixing, filtration, debubbling, filtering, spinning, degumming, drying, conditioning, canister forming and grading. The invention provides a new raw material and manufacturing technique for the viscose filament production, and the viscose filament prepared by the invention is of good white content, high breaking strength, and few disadvantage and can well fit the requirement of practical production.

The invention discloses a manufacturing method for shadow mask type plasma display panel front substrate metal electrode, which takes general sodium-calcium glass as the shadow mask type plasma display board front substrate and black glass slurry excluding sliver particles as bottom layer isolating material to increase thickness of the black glass slurry coated on the glass substrate, to reduce sintering temperature of the electrode, and to prevent sliver irons from dispersing into the glass substrate and reacting with elements like Na, K and so on in the process of sintering, thus reaching the effect of etiolation of the panel, in the meantime, the shadow mask type plasma display panel front substrate metal electrode whose parameters like size, shape and resistance meet the design requirement is obtained. The invention replaces PD200 glass with higher price and special for the plasma display panel by the general sodium-calcium glass and replaces the black glass slurry comprising silver by the black glass slurry excluding the sliver particles, which are both beneficial for lowering the manufacturing cost of the shadow mask type plasma display panel front substrate metal electrode. The invention uses the black glass slurry as the bottom layer isolating material to promote contrast grade of the shadow mask type plasma display panel and intensify adhesive force between the electrode and the glass substrate.

The invention discloses a making method of powder-shaped, insoluble, water, urine or blood adsorbable, high-etiolation resistant high-hydroscopicity resin, which is characterized by the following: adding high-whiteness insoluble inorganic salt powder in the manufacturing course; avoiding personal hygienic article from xanthating.

The invention discloses a lawn harmful nematode controlling method by applying the household refuse dunghill in the substrate. The lawn soil containing the nematode and the worked refuse dunghill are mixed evenly and combined by the ratio of 1:1-2.5 into a lawn implantation substrate; then the lawn grass seeds are sown into the substrate evenly; and then the lawn harmful nematode can be in control after 4-6 month lawn implantation. The controlling method of the invention is easy and practical, can control the phenomena of large area of etiolation, galls of the lawn leaves and roots existing in the lawn of the warmer areas and subtropical regions. By applying household refuses of different ratios, the invention can effectively control the growth of the harmful nematode in the lawn substrate, can ensure the lawn grass to grow exuberantly, can ensure the fine zoology function of the lawn, and then can improve the green sight effect of the lawn.