Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit for sieving medication of anti cell proliferation or anti tumor, sieving method and usage

An anti-tumor and drug technology, applied in the field of molecular biology and biochemistry

Inactive Publication Date: 2007-10-10
PEKING UNIV
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the regulatory mechanism and distribution of MST4 have not been elucidated, it has been reported that the phosphorylation and dimerization of mammalian Ste20-like kinases can regulate the phenomenon of nucleoplasmic shuttle transport

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for sieving medication of anti cell proliferation or anti tumor, sieving method and usage
  • Kit for sieving medication of anti cell proliferation or anti tumor, sieving method and usage
  • Kit for sieving medication of anti cell proliferation or anti tumor, sieving method and usage

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0223] Example 1 Study on the Expression of PDCD10 in Various Tumor Cell Lines

[0224] Culture cells according to conventional methods, using TRIZOL TM Reagents were used to extract total cellular RNA, and use Invitrogen's SuperScript II kit to synthesize single-stranded cDNA for PCR detection; extract cultured cell protein, and perform SDS-PAGE and Western blotting by conventional methods.

[0225] PCR utilizes the following PDCD10-specific primers:

[0226] Upstream primer: ATGAGGATGACAATGGAAGAGATG (SEQ ID NO: 1)

[0227] Downstream primer: TCAGGCCACAGTTTTGAAGGT (SEQ ID NO: 2)

[0228] And internal reference GAPDH-specific primers:

[0229] Upstream primer: CCACCCATGGCAAATTCCATGGCA (SEQ ID NO: 3)

[0230] Downstream primer: TCTAGACGGCAGGTCAGGTCAGGTCCACC (SEQ ID NO: 4)

[0231] Figure 1A shows that at the mRNA level, PDCD10 is expressed in various tumor cell lines. Figure 1B shows that at the protein level, PDCD10 is expressed in various tumor cell lines except HepG2 ...

Embodiment 2

[0232] Example 2 Yeast two-hybrid experiment

[0233] PDCD10 was constructed in the pGBK-RC bait vector, and yeast Y190 was co-transformed with the target vector of Shanghai Ruixing Company containing 1500 gene libraries known to be related to apoptosis, proliferation and cell cycle, and cultured in SD / -T-L-H medium The plasmids in the obtained positive yeast clones were extracted and transfected into Escherichia coli, and the target proteins caught by PDCD10 included MST4 and YSK1.

Embodiment 3

[0234] Example 3 Co-immunoprecipitation analysis

[0235] 1 Co-immunoprecipitation of overexpressed proteins

[0236] MST4 and YSK1 with c-Myc tag at N-terminus and PDCD10 with FLAG tag at N-terminus were constructed in pCDEF vector. Sequencing identified the correct DNA insert. Transiently transfect tagged recombinants into HEK293 cells by calcium phosphate transfection method. After 48 hours of transfection, wash the cells with PBS three times, scrape off the cultured cells, and centrifuge at 500g for 5 minutes. Cell clumps were lysed in cell lysate at 4°C and pipetted repeatedly with a needle. The lysate was centrifuged (20 minutes, 14,000 xg, 4°C) and the supernatant was mixed with 12.5 μl of anti-c-Myc or anti-FLAG M2 affinity agarose and incubated overnight (4°C). Immunosorbents were collected by centrifugation (5 min, 700×g), washed three times with lysate (5 min, 700×g), and washed with 50 mM Tris (pH 7.5) containing 0.1% (w / v) SDS and 150 mM NaCl Wash twice. Samp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

This invention discloses a test kit for screening anti-tumor drugs for inhibiting tumor cell proliferation. The test kit comprises: recombinant or natural PDCD10 molecules, recombinant or natural Ste20 kinase molecules, and natural or synthetic substrate of Ste20 kinase molecules. This invention also discloses the application of recombinant or natural Ste20 kinase in screening anti-tumor drugs for inhibiting tumor cell proliferation. This invention also provides a method for screening anti-tumor drugs for inhibiting tumor cell proliferation.

Description

technical field [0001] The invention relates to a screening kit for anti-cell proliferation and anti-tumor drugs, a screening method for anti-cell proliferation and anti-tumor drugs and the use of Ste20 family kinases in screening anti-cell proliferation and anti-tumor drugs. More specifically, it involves identifying and evaluating whether the drug is an anti-cell proliferation or anti-tumor drug by detecting the change in the activity of the Ste20 family kinase after adding the drug to be tested and recombinant or natural PDCD10. The invention belongs to the field of molecular biology and biochemistry. Background technique [0002] The invention uses PDCD10 gene and Ste20 family kinase to screen anti-cell proliferation and anti-tumor drugs. [0003] The PDCD10 gene (also named TFAR15) was cloned from TF-1 cells under the culture condition of removing the growth factor GM-CSF. The chromosome location is 3q26.1, the gene length is 50kb, and it encodes 212 amino acids. Throu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/48
Inventor 赵红珊马曦马大龙陈英玉张颖妹陈瑶瑶
Owner PEKING UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com