TAT-LBD-PEP fusion protein and application of TAT-LBD-PEP fusion protein in treatment of central nervous system lesion

A fusion protein, central nervous system technology, applied in the field of protein transduction, can solve the problem of difficult to achieve drug treatment concentration, and achieve the effects of enhancing targeting, increasing drug concentration, and reducing side effects

Inactive Publication Date: 2014-03-26
FOURTH MILITARY MEDICAL UNIVERSITY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, studies in recent years have found that: knocking out NgR1(- / -) or RNAi down-regulating the expression of NgR1, Nogo-66, MAG, and OMgp still have a strong inhibitory effect on axon growth, and it has been confirmed that NgR1 is only effective on Nogo-66, MAG , OMgp plays a key role in the acute growth cone collapse, but the chronic inhibitory effect on axonal growth is not necessary, thus strongly suggesting that there may be other receptors that play a more important role in this process
[0005] At present, in the research of macromolecular protein drugs for the treatment of central nervous system diseases, due to the existence of blood-brain barrier and blood-spine barrier, polypeptides larger than 6 amino acids generally cannot pass through these barriers, and it is difficult to achieve effective drug treatment concentrations.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • TAT-LBD-PEP fusion protein and application of TAT-LBD-PEP fusion protein in treatment of central nervous system lesion
  • TAT-LBD-PEP fusion protein and application of TAT-LBD-PEP fusion protein in treatment of central nervous system lesion
  • TAT-LBD-PEP fusion protein and application of TAT-LBD-PEP fusion protein in treatment of central nervous system lesion

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1: Construction, expression and identification of TAT-LBD-PEP fusion protein

[0032] The TAT-LBD-PEP fusion protein is prepared by fusing TAT and LBD-PEP, which specifically includes the following steps:

[0033] 1. Obtain the LBD gene and PEP sequence from Genebank, then connect the LBD gene and the PEP sequence through the GGCGGTGGCGGTTCA sequence to synthesize the LBD-PEP gene sequence, and make the two ends of the LBD-PEP gene sequence contain Nco I and Xho I sequences respectively , the gene sequence of the entire LBD-PEP is:

[0034] LBD-PEP cDNA sequence:

[0035] A CCATGG CC–CTGCCGGGCGCATCGGGCACCTGTCCGGAACGCGCACTGGAACGTCGTGAAGAAGAAGCAAATGTTGTCCTGACGGGTACGGTTGAAGAAATTCTGAACGTTGATCCGGTCCAGCATACCTATAGCTGCAAAGTCCGTGTGTGGCGCTACCTGAAAGGCAAGGATCTGGTGGCACGTGAAAGTCTGCTGGACGGCGGTAATAAGGTGGTTATTTCCGGCTTTGGTGATCCGCTGATCTGTGACAACCAAGTCAGTACCGGTGATACGCGCATCTTTTTCGTTAATCCGGCACCGCCGTATCTGTGGCCGGCACATAAAAACGAACTGATGCTGAATAGCTCTCTGATGCGTATTACGCTGCGCAACCTGGAAGAAGTGGAAT...

Embodiment 2

[0049] Example 2: Drug efficacy test of TAT-LBD-PEP fusion protein

[0050] (1) Identification of toxicity and transduction function of TAT-LBD-PEP fusion protein

[0051] 1. Toxicity analysis of different concentrations of TAT-LBD-PEP on primary neurons

[0052] (1) Primary culture of hippocampal neurons until day 5, adding purified fusion protein TAT-LBD-PEP (62.5 μg / l, 125 μg / l, 250 μg / l) and solvent (PBS);

[0053] (2) For normal culture, perform cell viability analysis (MTT method) at 12h, 24h, and 48h after adding protein.

[0054] 2. Identification of TAT-LBD-PEP fusion protein transduction and targeting

[0055] (1) Mouse model of global cerebral ischemia: BCCAO preparation;

[0056] (2) Animal grouping: TAT-LBD-PEP, TAT-PEP injection group, PBS injection group;

[0057] (3) Inject the above protein by intraperitoneal injection of 1 mg / kg and PBS into mice;

[0058] (4) At different times (6h, 12h, 24h) after injection, they were executed under anesthesia, fixed, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses TAT-LBD-PEP fusion protein and application of the TAT-LBD-PEP fusion protein in treatment of central nervous system lesion. The TAT-LBD-PEP fusion protein is combined with myelin inhibiting factors MAG, Nogo-66 and OMgp, accordingly the axon regenerative capacity is promoted through antagonism PirB effect, and the TAT-LBD-PEP fusion protein has the advantages of being high transduction efficiency and easily transmitting a blood-spinal barrier and a blood brain barrier, can transduce targeting to a hurt region and has the enrichment effect on an ischemic region. The problems that additional harm of nervous tissues is caused by the protein injection in a micro-injection mode or other injection modes and macromolecule cannot transmit the blood-spinal barrier and the blood brain barrier are solved, and the shortcoming that corresponding biological concentration cannot be met is overcome, and the targeting is transduced to the ischemic region through a ligand binding domain (LBD). The TAT-LBD-PEP fusion protein can be prepared in large-scale mode, is low in cost and high in activity, and is used for treatment of various brain and spinal cord injury including cerebral ischemia hypoxia, cerebral hemorrhage, cerebral trauma, spinal cord injury and the like and promoting regeneration of nervous tissues and neural functional recovery.

Description

technical field [0001] The present invention belongs to the field of protein transduction, and specifically relates to a method of preparing a TAT-LBD-PEP fusion protein by fusing TAT, LBD and PEP, and at the same time, the TAT-LBD-PEP fusion protein involved in the present invention penetrates the blood-brain barrier and accumulates damage Area, can be used for the treatment of central nervous system injury. Background technique [0002] According to the recent survey results of WHO: First, the number of new patients with cerebrovascular diseases such as cerebral infarction and cerebral hemorrhage in my country is between 2 million and 2.5 million, and the annual death toll is as high as 1.5 million, which is still increasing at a rate of 8.7%. , its morbidity and mortality rate ranks first in the world; second, my country's annual death toll due to traffic accidents exceeds 100,000, and the number of disabled people exceeds 500,000, far exceeding the number of casualties in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K19/00C12N15/62A61K38/17A61K47/48A61P25/00
Inventor王强郭钒苟兴春邓斌熊利泽
OwnerFOURTH MILITARY MEDICAL UNIVERSITY