Unlock instant, AI-driven research and patent intelligence for your innovation.

Simultaneous rapid and accurate detection of live vomitoxin-producing and non-emetoxin-producing bacillus cereus kit and detection method in food

A technology of Bacillus cereus and DON, applied in the field of microbial detection, can solve the problems of high labor intensity, wrong identification, poor specificity, etc., and achieve the effects of simple operation, fast speed and simple result judgment.

Active Publication Date: 2015-09-02
WUXI ZODOLABS BIOTECH
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Traditional methods have the disadvantages of high labor intensity, time-consuming, high cost, and poor specificity, which can easily cause a large number of misidentifications

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Simultaneous rapid and accurate detection of live vomitoxin-producing and non-emetoxin-producing bacillus cereus kit and detection method in food
  • Simultaneous rapid and accurate detection of live vomitoxin-producing and non-emetoxin-producing bacillus cereus kit and detection method in food
  • Simultaneous rapid and accurate detection of live vomitoxin-producing and non-emetoxin-producing bacillus cereus kit and detection method in food

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] A kit for rapidly and accurately detecting live vomitoxin-producing and non-doxytoxin-producing Bacillus cereus in food at the same time, which is characterized in that the primers are: from 5'-3' to

[0042] cesB-F:ACCCATCTTGCGTCATT

[0043] cesB-R:CAGCCAAGTGAAGAATACC

[0044] 16S-F:GCGGCGTGCCTAATACATGC

[0045] 16S-R: CTCAGGTCGGCTACGCATCG

[0046] IAC-F:CCTACGGGAGGCAGCAGT

[0047] IAC-R: CGTTTACGGCGTGGACTAC.

[0048]The kit also contains propidium azide bromide PMA (purchased from Biotium, USA), PBS phosphate buffer saline, and Taq mix (purchased from TaKaRa, Japan).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of the detection of microorganisms and discloses a method for rapidly and accurately detecting live waxy bacilli capable of producing vomitoxin and waxy bacilli incapable of producing vomitoxin simultaneously. A specific primer is designed aiming to (i)cesB( / i) of waxy bacilli encoded vomitoxin and (i)16SrRNA( / i) of waxy bacilli; the interference of dead waxy bacilli in foods is removed by using propidium monoazide (PMA); the DNA of live bacilli in foods is extracted through a boiling water bath method; polymerase chain reaction (PCR) detection is repeatedly carried out; a possible false negative result in a PCR system is indicated through the addition of non-competitive internal amplification control (IAC). By adopting the method, the interference of normal false positive and negative results in the detection through a molecular biological method is avoided and then detection result is more accurate; meanwhile, the detection time of the method is shorter than that of a traditional culture method.

Description

technical field [0001] The invention belongs to the field of microorganism detection, and in particular relates to a method for rapidly and simultaneously detecting live vomitoxin-producing and non-emetoxin-producing bacillus cereus in food. technical background [0002] Bacillus cereus is a Gram-positive spore-forming bacterium that is widely distributed in air, sewage, and various raw and cooked foods. At present, this bacterium has been isolated from a variety of foods, including fried rice, meat, milk and fish, etc. It is a common food-borne pathogen and is very likely to endanger people's health. In my country, the poisoning incidents caused by Bacillus cereus are relatively serious. During the ten years from 1993 to 2003, there were as many as 1758 people who were poisoned by Bacillus cereus. The poisoning symptoms caused by Bacillus cereus mainly include vomiting and diarrhea. There are many studies on foodborne diseases caused by enterotoxins, and the detection meth...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12Q1/04
CPCC12Q1/04C12Q1/6848C12Q1/686C12Q2545/101C12Q2549/125C12Q2537/143
Inventor 李林杨晓慧许恒毅徐波
Owner WUXI ZODOLABS BIOTECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More