Unlock instant, AI-driven research and patent intelligence for your innovation.

Efficient virus-induced phytoene desaturase gene silence system for Chinese pink

A technology of phytoene and dehydrogenase, applied in the field of high-efficiency silencing system of dianthus phytoene dehydrogenase gene

Inactive Publication Date: 2016-02-03
INNER MONGOLIA AGRICULTURAL UNIVERSITY
View PDF3 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] In order to solve the above problems, the present invention provides a virus-induced high-efficiency silencing system for the dianthus phytoene dehydrogenase gene, which can obtain virus-induced gene silencing traits, and further solve the problem of effectively verifying the function of the dianthus gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Efficient virus-induced phytoene desaturase gene silence system for Chinese pink
  • Efficient virus-induced phytoene desaturase gene silence system for Chinese pink
  • Efficient virus-induced phytoene desaturase gene silence system for Chinese pink

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0032] Step 1: Design primers to amplify PDS fragments of different sizes, the primers are

[0033] 4F: GATGAGGATGGGGACTGGTA

[0034] 4R: ATTTAGCGCCTTTGACATGG

[0035] 6F: AAGGTTGCTGCTTGGAAAGA

[0036] 6R: GGCCAAGTCAGCATTTCATT;

[0037] Step 2, amplified by RT-PCR, using 4F and 4R as primers to amplify a 500bp fragment; using 6F and 6R as a primer to amplify a 260bp fragment;

[0038] Step 3. The obtained fragments were connected to pGEMT-easy for sequencing, and the comparison results were as follows ( figure 2 ). It indicated that the amplified fragment had high homology with PDS gene.

[0039] Step 4: Digest the PDS fragment connected to the vector pGEMT-easy and connect it to the TRV2 vector after the same digestion, and then carry out digestion verification. After pTRV2-PDS500 and pTRV2-PDS260 were cleaved by EcoRI, 10.0kb and 500bp, and 10.0kb and 260bp restriction fragments were obtained respectively.

[0040] Step 5, transfer the TRV2 linked with different PDS ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an efficient virus-induced phytoene desaturase gene silence system for Chinese pink. A specific primer is designed according to a coding gene sequence of PDS (phytoene desaturase), and about 500bp cDNA (complementary deoxyribonucleic acid) fragments are amplified in the Chinese pink through RT-PCR (reverse transcription-polymerase chain reaction). Obtained PDS cDNA fragments are connected to TRV2, and acetosyringone concentration, seedling age and preculture temperature after infection as well as light conditions for plants after preculture are integrated in an assorted manner by optimizing an agrobacterium-mediated virus-induced gene silence system according to photobleaching frequency, bleached leaf area and bleached conditions of the plants, so that the rapid efficient virus-induced silence system is established, virus-induced gene silence character can be obtained, and further, the problem that Chinese pink gene functions are verified effectively is solved.

Description

technical field [0001] The invention relates to the field of flower biotechnology, in particular to a virus-induced high-efficiency silencing system for the dianthus phytoene dehydrogenase gene. Background technique [0002] Dianthus is a plant of the genus Dianthus in the family Caryophyllaceae, native to China. Because of its advantages such as cold resistance, drought resistance, salt-alkali resistance, and many colors, it is widely used in gardens such as flower beds and ground covers. Studying the stress resistance mechanism of Dianthus chinensis, obtaining stress resistance genes, and then genetically improving the plants of the same genus can increase the types of plants used in northern gardens and achieve the purpose of economical greening. However, there is currently a lack of a system for rapid and effective verification of the functions of genes controlling these traits. VIGS (virus-induced gene silence, VIGS) technology has been applied to a variety of plants f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/84A01H5/00
Inventor 贺学勤张婧
Owner INNER MONGOLIA AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More