Primer pair for identifying enteromorpha sibling species, DNA (Deoxyribonucleic Acid) bar code, and application and detection methods thereof

A related species and barcode technology, applied in biochemical equipment and methods, recombinant DNA technology, DNA / RNA fragments, etc., can solve the problems of high DNA barcode sequence similarity and inability to distinguish species, and achieve a breakthrough in over-reliance and accurate The effect of carrying out the identification

Active Publication Date: 2018-05-04
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Ulva green algae generally use DNA sequence fragments such as ITS and rbcL as DNA barcodes for species identification. However, for the related species of Enteromorpha and Enteromorpha spp., when using the commonly used molecular markers such as ITS and rbcL , the sequence similarity of the obtained DNA barcodes is very high, and they are clustered into a homologous clade in the phylogenetic analysis, and the two species cannot be effectively distinguished

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer pair for identifying enteromorpha sibling species, DNA (Deoxyribonucleic Acid) bar code, and application and detection methods thereof
  • Primer pair for identifying enteromorpha sibling species, DNA (Deoxyribonucleic Acid) bar code, and application and detection methods thereof
  • Primer pair for identifying enteromorpha sibling species, DNA (Deoxyribonucleic Acid) bar code, and application and detection methods thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Acquisition of the DNA barcode rps7-ycf3 from the relative species of Enteromorpha

[0030] 1) Comparative analysis of chloroplast genomes of related species of Enteromorpha: .

[0031] The chloroplast genome sequences of Enteromorpha and Enteromorpha spp. were obtained from the National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov / ) (En. KX058323.1), using the Clustal W module in the MEGA7.0 software for genome comparison, according to the results of the chloroplast genome comparison, first find the segments with low sequence consistency between the two species, and further screen out the segments belonging to The segment of the intergenic region, and finally determined that the candidate segment is the intergenic region of rps7-ycf3 ( figure 1 ).

[0032] 2) Design of rps7-ycf3 sequence primer pair:

[0033] Using the upstream and downstream sequences of the intergenic region of rps7-ycf3 obtained above as a template, the sequence informa...

Embodiment 2

[0051] The Ulva sample collected from Xixiakou, Rongcheng, Shandong Province was preliminarily determined to be a type of Enteromorpha, but its species could not be confirmed. Carry out comparative identification with the inventive method:

[0052] Specific steps are as follows:

[0053] 1) Utilize conventional method to extract the DNA of the sample to be tested for use;

[0054] 2) PCR amplification:

[0055] Using the sample obtained in step 1) as a template, the primers obtained in the above examples and the Ulva ITS universal primer were used for PCR amplification respectively. The PCR conditions were: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30s, annealing at 55°C for 40s, and 72°C Extend at ℃ for 40s, 35 cycles; finally extend at 72℃ for 10min.

[0056] The PCR system is:

[0057]

[0058] 3) Sequencing by the above-mentioned PCR amplification product:

[0059] The nucleotide sequence of the rps7-ycf3 fragment was determined as:

[0060]...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of alga molecular markers, and concretely relates to a primer pair for identifying enteromorpha sibling species, a DNA (Deoxyribonucleic Acid) bar code, and application and detection methods thereof. The primer pair for identifying the enteromorpha sibling species comprises: an upstream primer sequence: 5'GCTGACATACCATCACGATAGT 3'(SEQ ID U01); a downstream primer sequence: 5'CGTATTATTTCACCAGACCCTT 3'(SEQ ID U02). The invention relates to application of the primer pair in identifying the enteromorpha sibling species. The primer pair for identifying the enteromorpha sibling species, the DNA bar code, and the application and detection methods thereof provided by the invention are strong supplement for traditional species identification, automationand standardization can be realized during a sample identification process, the heavy dependency on experiences is broken, fragments of algae can be utilized for being quickly and effectively identified, and an application system easy to use can be built within a shorter time.

Description

technical field [0001] The invention belongs to the technical field of algae molecular markers, and in particular relates to a pair of primers for identifying DNA barcodes of Enteromorpha close relatives, a DNA barcode, and an application and detection method thereof. Background technique [0002] Ulva prolifera, Ulva linza and Ulva flexuosa are closely related species belonging to the genus Ulva, all of which are edible green algae, but their massive proliferation will cause ecological disasters, For example, the "green tide" disaster caused by the explosive proliferation of Enteromorpha has occurred continuously in the Yellow Sea of ​​my country since 2007. Widely concerned by society, media, government and related scholars. [0003] The current identification methods for green algae of Ulva genus include morphological observation, hybridization experiment identification and DNA barcode identification, etc. Traditional morphological identification is mainly based on morpho...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12Q1/686C12N15/11
CPCC12Q1/686C12Q1/6895C12Q2565/125
Inventor高大海孙忠民姚建亭
OwnerINST OF OCEANOLOGY - CHINESE ACAD OF SCI