Supercharge Your Innovation With Domain-Expert AI Agents!

Drug-loaded vesicle

A vesicle and drug-loading technology, which is applied in the direction of antineoplastic drugs, drug combinations, and pharmaceutical formulations, can solve problems such as limiting the chemotaxis of drug-loaded vesicles, and achieve stable and efficient tumor killing effects and good therapeutic effects

Active Publication Date: 2020-04-28
HUBEI SOUNDNY BIOLOGICAL TECH
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Intracellular UDPG content tends to be low, limiting chemotaxis of drug-loaded vesicles to neutrophils

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Drug-loaded vesicle
  • Drug-loaded vesicle
  • Drug-loaded vesicle

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1 Construction of recombinant plasmids

[0045] 1. Experimental materials and instruments

[0046] Tumor cells such as human ovarian cancer cell A2780 were purchased from ATCC or CCTCC; pcDNA3.1 / Hygromycin (+) and pcDNA3.3-TOPO plasmids were purchased from ThermoFisher; Trizol Total RNA Extraction Reagent, BeyoRTⅢ cDNA First Strand Synthesis Kit: Purchased from Biyuntian Biotech; Trans5αChemically Competent Cell, TransStartFastPfu DNA Polymerase: purchased from Beijing Quanshijin Biology; GenBuilder Cloning kit: purchased from Nanjing GenScript; Restriction enzymes NheI and NotI: both purchased from NEB Company; Endotoxin plasmid mini-extraction kit: purchased from Tiangen Biotech; UDPG: purchased from Merck Company; high performance liquid chromatography: Thermo Company, Ultimate3000 type; PCR instrument: BIOER Company, LifeTouch type.

[0047] 2. Experimental steps

[0048] (1) Detection of UDPG content in cells by HPLC:

[0049] Mobile phase: 0.125M KH ...

Embodiment 2

[0065]atgtcgagatttgtacaagatcttagcaaagcaatgtctcaagatggtgcttctcagttccaagaagtcattcggcaagagctagaattatctgtgaagaaggaactagaaaaaatactcaccacagcatcatcacatgaatttgagcacaccaaaaaagacctggatggatttcggaagctatttcatagatttttgcaagaaaaggggccttctgtggattggggaaaaatccagagaccccctgaagattcgattcaaccctatgaaaagataaaggccaggggcttgcctgataatatatcttccgtgttgaacaaactagtggtggtgaaactcaatggtggtttgggaaccagcatgggctgcaaaggccctaaaagtctgattggtgtgaggaatgagaatacctttctggatctgactgttcagcaaattgaacatttgaataaaacctacaatacagatgttcctcttgttttaatgaactcttttaacacggatgaagataccaaaaaaatactacagaagtacaatcattgtcgtgtgaaaatctacactttcaatcaaagcaggtacccgaggattaataaagaatctttacttcctgtagcaaaggacgtgtcttactcaggggaaaatacagaagcttggtaccctccaggtcatggtgatatttacgccagtttctacaactctggattgcttgatacctttataggagaaggcaaagagtatatttttgtgtctaacatagataatctgggtgccacagtggatctgtatattcttaatcatctaatgaacccacccaatggaaaacgctgtgaatttgtcatggaagtcacaaataaaacacgtgcagatgtaaagggcgggacactcactcaatatgaaggcaaactgagactggtggaaattgctcaagtgccaaaagcacatgtagacgagttcaagtctgtatcaaagttcaaaatatttaatacaaa...

Embodiment 3

[0072] Example 3 Neutrophil transwell in vitro chemotaxis assay

[0073] 1. Experimental materials and instruments

[0074] Transwell chamber: purchased from Corning Company; inverted microscope: Leica Company, DMIL-PH2 type.

[0075] 2. Experimental steps

[0076] Add neutrophils isolated from mouse bone marrow and serum-free medium to the upper chamber of the Transwell chamber, add vesicles secreted by cells transfected and untransfected with PGM1 and UGPase2 genes respectively in the lower chamber, incubate for 1 hour, and collect neutrophils in the lower chamber Cells are counted.

[0077] 3. Experimental results

[0078] The results showed that after transfection of PGM1 and UGPase2 genes, the ability of vesicles to chemoattract neutrophils was significantly improved, and the number of chemoattracted neutrophils in the PGM1-UGPase2 / H22 cell vesicle group was 2.42 times that of the control group ( Figure 4 ).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention relates to a drug-loaded vesicle. The drug-loaded vesicle comprises a vesicle derived from tumor cells and a therapeutic drug wrapped in the vesicle. The tumor cell-derived vesicle is avesicle released by apoptotic tumor cells, a large amount of uridine diphosphate glucose is wrapped in the vesicle, and the therapeutic drug is a tumor therapeutic drug serving as an effective component for treating tumors. The drug-loaded vesicle provided by the invention obtains a more stable and efficient tumor killing effect, and can better treat tumor diseases.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a drug-loaded vesicle, its preparation method and application. Background technique [0002] Cells are composed of cell membranes enclosing their contents, and their spherical structure is maintained by the centripetal pull formed by protein filaments called the cytoskeleton within the cell. After receiving exogenous or endogenous stimuli, the cytoskeleton will rearrange, resulting in uneven local force on the cell membrane, and the substances in the cytoplasm are wrapped by the cell membrane and released to the outside of the cell in the form of vesicles. This special subcellular structure with a diameter of 0.1-1 μm is called a cell vesicle. [0003] Neutrophils are the most numerous immune cells among white blood cells, accounting for 50%-70% of circulating white blood cells, and are the first line of defense of the immune system. The treatment of malignant tumors by activating ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K9/127A61K47/46A61K31/519A61K35/15A61P35/00A61P35/02C12N5/10
CPCA61K9/127A61K47/46A61K31/519A61K35/15A61P35/00A61P35/02C12N9/90C12N9/1241C12Y504/02002C12Y207/07009A61K2300/00
Inventor 尹江峰张一杨帆
Owner HUBEI SOUNDNY BIOLOGICAL TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More