a drug-loaded vesicle
A vesicle and drug-loading technology, applied in the biological field, can solve problems such as limiting the chemotaxis of drug-loaded vesicles, and achieve stable and efficient tumor killing effects and good therapeutic effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Example 1 Construction of recombinant plasmids
[0045] 1. Experimental materials and instruments
[0046] Tumor cells such as human ovarian cancer cell A2780 were purchased from ATCC or CCTCC; pcDNA3.1 / Hygromycin (+) and pcDNA3.3-TOPO plasmids were purchased from ThermoFisher; Trizol Total RNA Extraction Reagent, BeyoRTⅢ cDNA First Strand Synthesis Kit: Purchased from Biyuntian Biotech; Trans5αChemically Competent Cell, TransStartFastPfu DNA Polymerase: purchased from Beijing Quanshijin Biology; GenBuilder Cloning kit: purchased from Nanjing GenScript; Restriction enzymes NheI and NotI: both purchased from NEB Company; Endotoxin plasmid mini-extraction kit: purchased from Tiangen Biotech; UDPG: purchased from Merck Company; high performance liquid chromatography: Thermo Company, Ultimate3000 type; PCR instrument: BIOER Company, LifeTouch type.
[0047] 2. Experimental steps
[0048] (1) HPLC method to detect UDPG content in cells:
[0049] Mobile phase: 0.125M KH ...
Embodiment 2
[0065]atgtcgagatttgtacaagatcttagcaaagcaatgtctcaagatggtgcttctcagttccaagaagtcattcggcaagagctagaattatctgtgaagaaggaactagaaaaaatactcaccacagcatcatcacatgaatttgagcacaccaaaaaagacctggatggatttcggaagctatttcatagatttttgcaagaaaaggggccttctgtggattggggaaaaatccagagaccccctgaagattcgattcaaccctatgaaaagataaaggccaggggcttgcctgataatatatcttccgtgttgaacaaactagtggtggtgaaactcaatggtggtttgggaaccagcatgggctgcaaaggccctaaaagtctgattggtgtgaggaatgagaatacctttctggatctgactgttcagcaaattgaacatttgaataaaacctacaatacagatgttcctcttgttttaatgaactcttttaacacggatgaagataccaaaaaaatactacagaagtacaatcattgtcgtgtgaaaatctacactttcaatcaaagcaggtacccgaggattaataaagaatctttacttcctgtagcaaaggacgtgtcttactcaggggaaaatacagaagcttggtaccctccaggtcatggtgatatttacgccagtttctacaactctggattgcttgatacctttataggagaaggcaaagagtatatttttgtgtctaacatagataatctgggtgccacagtggatctgtatattcttaatcatctaatgaacccacccaatggaaaacgctgtgaatttgtcatggaagtcacaaataaaacacgtgcagatgtaaagggcgggacactcactcaatatgaaggcaaactgagactggtggaaattgctcaagtgccaaaagcacatgtagacgagttcaagtctgtatcaaagttcaaaatatttaatacaaa...
Embodiment 3
[0072] Example 3 Neutrophil transwell in vitro chemotaxis assay
[0073] 1. Experimental materials and instruments
[0074] Transwell chamber: purchased from Corning Company; inverted microscope: Leica Company, DMIL-PH2 type.
[0075] 2. Experimental steps
[0076] Add neutrophils isolated from mouse bone marrow and serum-free medium to the upper chamber of the Transwell chamber, add vesicles secreted by cells transfected and untransfected with PGM1 and UGPase2 genes respectively in the lower chamber, incubate for 1 hour, and collect neutrophils in the lower chamber Cells are counted.
[0077] 3. Experimental results
[0078] The results showed that after transfection of PGM1 and UGPase2 genes, the ability of vesicles to chemoattract neutrophils was significantly improved, and the number of chemoattracted neutrophils in the PGM1-UGPase2 / H22 cell vesicle group was 2.42 times that of the control group ( Figure 4 ).
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


