A method for editing gene fusions

An editing and gene technology, applied in the molecular field, can solve problems such as unfavorable molecular diagnostic detection performance, termination, non-physiological level of fusion genes, etc., to overcome the inaccuracy of breakpoint sequences and improve the success rate.

Active Publication Date: 2022-02-01
菁良科技(深圳)有限公司
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the above methods have their own problems: (1) the expression of the fusion gene is not at a physiological level; (2) the fusion gene cannot be completely silenced; (3) the patient-derived cell line cannot reproduce the initial stage of cancer development in vivo
This inaccurate breakpoint has a potential impact on the function of the fusion gene, especially the fusion between exons, such as COSF571 ( ETV6 Gene exon 5 and NTRK3 fusion between gene exon 15), COSF1434 ( FGFR3 Gene exon 17 and TACC3 The fusion between the 10th exon of the gene), etc., the inaccurate connection at the breakpoint will cause the destruction of the open reading frame or the premature termination of the translation due to the frameshift mutation during the translation process, and finally cannot form a functional protein; at the same time, inaccurate breakpoints are not conducive to the evaluation of the performance of molecular diagnostic tests in clinical practice
Currently, there is no method in the literature that enables accurate editing of fusion gene breakpoints

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for editing gene fusions
  • A method for editing gene fusions
  • A method for editing gene fusions

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Example 1 Editing of fusion gene COSF571

[0054] COSF571 is ETV6 Gene (ENST00000396373.8) exon 5 and NTRK3 For the fusion between the 15th exon of the gene (ENST00000394480.6), the sequences of 200 bp upstream and downstream of the natural breakpoint were respectively selected for display. The sequence is shown in SEQ ID NO.1, and the details are as follows:

[0055] CAGCCCCATCATGCACCCTCTGATCCTGAACCCCCGGCACTCCGTGGATTTCAAACAGTCCAGGCTCT CCGAGGACGGGCTGCATAGGGAAGGGAAGCCCATCAAACCTCTCTCATCGGGAAGACCTGGCTTACATGAACCACAT CATGGTCTCTGTCTCCCCGCCTGAAGAGCACGCCATGCCCATTGGGAGAATAGCAG / / ATGTGCAGCACATTAAGA GGAGAGACATCGTGCTGAAGCGAGAACTGGGTGAGGGAGCCTTTGGAAAGGTCTTCCTGGCCGAGTGCTACAACCT CAGCCCGACCAAGGACAAGATGCTTGTGGCTGTGAAGgtaaaccccagaggcatgccggcaccaggagggagggctg gctgagggcccagggagggaaggaagaggc

[0056] Among them, the italic part is ETV6 gene sequence; the underlined part is NTRK3 Gene sequence, " / / " is the natural breakpoint position of the fusion gene, NTRK3 Capital ...

Embodiment 2

[0081] Example 2 Editing of fusion gene ROR1-DNAJC6

[0082] ROR1-DNAJC6 is ROR1 Partial region of exon 9 of gene (ENST00000371079.6) and DNAJC6 For the fusion between the first intron of the gene (ENST00000371069.5), the sequences of 200 bp upstream and downstream of the natural breakpoint were respectively selected for display. The sequence is shown in SEQ ID NO.14, and the details are as follows:

[0083] TCTCTTCTGATTCAGATATCTGGTCCTTTGGGGTTGTCTTGTGGGAGATTTTCAGTTTTGGACTCCAG CCATATTATGGATTCAGTAACCAGGAAGTGATTGAGATGGTGAGAAAACGGCAGCTCTTACCATGCTCTGAAGACT GCCCACCCAGAATGTACAGCCTCATGACAGAGTGCTGGAATGAGATTCCTTCTAGG / / aaacaacttcccaaggtt gtacagcgattacagggtgaagctgccacctgtttatcttagtgcactggagcctgaggtcattgcccactcagtt tgatgccagacagaccagagttgctcattaacacttcataaagccctctcatgttcctcataataaccagacattt ctaattataacttgagcagcaaatgttgtt

[0084] The italic part of the sequence is ROR1 Gene sequence, the underlined part is DNAJC6 Gene sequence, " / / " is the natural breakpoint position...

Embodiment 3

[0098] Example 3 Editing of fusion gene COSF1347

[0099] COSF1347 is FGFR3 Gene (ENST00000440486.8) intron 17 and BAIAP2L1 For the fusion between the first intron of the gene (ENST00000005260.9), the sequences of 200 bp upstream and downstream of the natural breakpoint were respectively selected for display. The sequence is shown in SEQ ID NO.19, and the details are as follows:

[0100] CTTCAAGCAGCTGGTGGAGGACCTGGACCGTGTCCTTACCGTGACGTCCACCGACgtgagtgctggct ctggcctggtgccacccgcctatgcccctccccctgccgtccccggccatcctgccccccagagtgctgaggtgtg gggcgggccttctggggcacagcctgggcacagaggtggctgtgcgaagaggggct / / ctttccacctcggggttc agaaggggactttacgcgggaaggtactttccctccctccagctcccctcccccgcgtccttccacctctcccggt ctctcccactcctcccctggccctccacagcccctcttcttcctcccctggccctctccttcctcccagtccctcc ccatcccctcccccctacttttcctcctcc

[0101] The italic part of the sequence is FGFR3 Gene sequence, the underlined part is BAIAP2L1 Gene sequence, " / / " is the natural breakpoint position of the fusion gen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a fusion gene editing method, which is characterized in that the editing method includes: (1) designing a sgRNA near the natural breakpoints of the two genes involved in the fusion; (2) designing a recombinant The AAV vector enables homologous recombination repair of two DNA breaks. Using this method can ensure that no matter the natural breakpoint is within an exon, an exon boundary or an intron region, the sequence of the obtained fusion gene is completely consistent with the natural sequence, which overcomes the inaccurate breakpoint sequence of the existing method. question.

Description

technical field [0001] The invention belongs to the field of molecular technology, and in particular relates to a method for editing gene fusion. Background technique [0002] Fusion gene refers to the process of fusion of all or part of the sequences of two genes into a new gene, which may be the result of chromosomal translocation, middle deletion or chromosomal inversion. Among them, chromosomal translocation is an important way to form fusion genes. The main reason is that DNA double-strand breaks or two adjacent DNA single-strand breaks are repaired incorrectly, resulting in changes in the position of chromosome fragments. Fusion genes can produce tumorigenesis through two mechanisms: one is the overexpression of a gene at one of the breakpoints, and the other is the fusion of two genes to generate a hybrid gene. At present, more than 300 fusion genes have been found in various hematological and solid tumors, and there is a large amount of evidence that gene fusion cau...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/90C12N15/66C12N15/63C12N15/113
CPCC12N15/902C12N15/66C12N15/63C12N15/113C12N2310/10
Inventor李菁华修毓雯耿汇津刘楚新涂英美许滢琳
Owner菁良科技(深圳)有限公司