Oligonucleotide series for calculation of DNA chip

A computing chip and oligonucleotide technology, which is applied in the field of oligonucleotide sequences of DNA computing chips, can solve the problems of weak signal, failure to ensure hybridization stability and no hybridization mismatch, poor hybridization stability, etc.

Inactive Publication Date: 2007-03-07
SHANGHAI JIAOTONG UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, for the hybridization reaction on the surface of the chip, due to the requirement of the hybridization stability of the oligonucleotide sequence, the sequence length usually needs to exceed 12 bases. If it is lower than this length, the hybridization stability is poor and the signal is weak.
Although Frutns et al. designed 108 sequences, the length of the variable region of these sequences is only 8 bases. If they are used for DNA chip calculations, they cannot guarantee hybridization stability and no hybridization mismatches at the same time.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Oligonucleotide series for calculation of DNA chip

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] 12-base variable parent sequence (n=22) pairing test results (comparison scores are expressed in matrix arrangement):

[0050] Constraint condition (3) test result of "comparison score between any sequence A and any other sequence B" in the summary of the invention, wherein the first row and the first column both represent the serial numbers of the oligonucleotide sequences, and the values ​​in the table Represents the alignment score (the 12 on the diagonal represents the alignment score between the sequence and itself):

[0051] 01

[0052] 01

[0053] 11

[0054] The above test results show that the selected 22 sequences all meet the constraint conditions (3) and (4) in the content of the invention in the description, that is, the comparison scores are not greater than 4.

Embodiment 2

[0056] A 4-variable SAT problem is encoded with the parent sequence, and arranged as a computing chip.

[0057] For a 4-variable SAT problem such as

[0058] F=(w∨x∨y)∧(w∨y∨z)∧(x∨y)∧(w∨y)

[0059] gcagtatccaca aggaactgagct

ctctgattcgtcacccaaatcgca

gatcacatgcgt tgaagcgcgtta

aagacgggaaac gcgtaaatgctg

[0060] variable value

Sequence immobilized on chip (5'-3')

Fully paired probes (5'-3')

X=1

NH 2 -AAA AAA AAA AAA AAA gcagtatccaca

FAM-tgtggatactgc

X=0

NH 2 -AAA AAA AAA AAA AAA aggaactgagct

FAM-agctcagttcct

Y=1

NH 2 -AAA AAA AAA AAA AAA ctctgattcgtc

FAM-gacgaatcagag

[0061] Y=0

NH 2 -AAA AAA AAA AAA AAA acccaaatcgca

FAM-tgcgatttgggt

Z=1

NH 2 -AAA AAA AAA AAA AAA gatcacatgcgt

FAM-acgcatgtgatc

Z=0

NH 2 -AAA AAA AAA AAA AAA tgaagcgcgtta

FAM-taacgcgcttca

W=1

NH 2 -AAA AAA AAA AAA AAA aagacgggaaac

...

Embodiment 3

[0074] The same 4-variable SAT problem as in Example 2 is encoded with the extended sequence, and arranged as a computing chip.

[0075] First pair: cagactagcctt aaggctagtctg

Second pair: ctctgattcgtc gacgaatcagag

Third pair: caaggacatacg cgtatgtccttg

Fourth pair: tcgctaaagggt accctttagcga

[0076] variable value

Sequence immobilized on chip (5'-3')

Fully paired probes (5'-3')

X=1

NH 2 -AAA AAA AAA AAA AAA cagactagcctt

FAM-aaggctagtctg

X=0

NH 2 -AAA AAA AAA AAA AAA aaggctagtctg

FAM-cagactagcctt

Y=1

NH 2 -AAA AAA AAA AAA AAA ctctgattcgtc

FAM-gacgaatcagag

[0077] Y=0

NH 2 -AAA AAA AAA AAA AAA gacgaat cagag

FAM-ctctgattcgtc

Z=1

NH 2 -AAA AAA AAA AAA AAA caaggacatacg

FAM-cgtatgtccttg

Z=0

NH 2 -AAA AAA AAA AAA AAA cgtatgtccttg

FAM-caaggacatacg

W=1

NH 2 -AAA AAA AAA AAA AAA tcgctaaagggt

FAM-accct...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A group of oligonucleotide sequences used for the calculation of DNA chip features that the length of its each sequence is 12 bases, and its each sequence can meet such restrictive conditions that 22 mother sequences are generated, the content of G+C is 90%, and the ratio of any sequence to another sequence is not greater than 4.

Description

technical field [0001] The present invention relates to an oligonucleotide sequence in the field of gene technology, in particular to an oligonucleotide sequence used in a DNA computing chip. Background technique [0002] DNA computing is a new field developed in recent years. In 1994, Adleman (Science, 1994, 266: 1021-1024) used DNA sequence as the information carrier for the first time, and used molecular biology test technology to solve the Hamilton path problem of the seven vertices in the test tube. Later, many scholars proposed a variety of DNA calculation models for different NP problems, and these DNA calculations are all calculations in the solution system. Although a variety of DNA calculations can be realized in the solution, there are still some insurmountable problems in the reaction in the solution, such as the difficulty of separating intermediate products, the complexity of the reaction system, the difficulty of monitoring the intermediate process, the poor ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/00
Inventor张晓东吕鸣胡钧贺林张治洲
OwnerSHANGHAI JIAOTONG UNIV