14results about How to "Improve inflammatory response" patented technology

The invention discloses an acne-removing essence and a preparation method thereof, and particularly relates to the technical field of skin care products, the acne-removing essence comprises the following components by mass: 0.5-5% of salicylic acid; 1%-5% of tartaric acid; 2%-6% of nicotinamide; 0.5%-2% of colloidal sulfur; 1.5%-3% of tea tree essential oil; 1%-2% of hyaluronic acid; 0.5%-1% of ceramide; 1%-3% of glycerol; 1%-2% of trehalose; the salicylic acid is used for penetrating into skin, helping to relieve dead skin cells, reducing inflammation and accelerating skin renewal; the tartaric acid is used for realizing a stripping effect, can remove aged cuticles on the surface of the skin and promote the generation of new cells, so that the problem of acnes is helped to be improved. The acne-removing essence prepared by the invention has a relatively good moisturizing effect, so that skin barrier can be well maintained, keratin metabolism is promoted, grease secretion is inhibited, acne is effectively prevented, inflammatory response of the acne is relieved, and the actual use effect of the acne-removing essence is relatively good.

The invention provides application of baicalin in preparation of a medicine for treating streptococcus agalactiae induced mastitis, and relates to the technical field of medicine. A mouse is selected as an animal model to research the intervention effect and mechanism of the baicalin on the streptococcus agalactiae induced mouse mastitis inflammatory response, and it is clear that the baicalin can play a role in protecting the mouse mammary gland by regulating and controlling an NLRP3 inflammatory small body pathway; a reference basis is provided for treating the cow mastitis caused by streptococcus agalactiae infection by applying the baicalin.

The invention discloses an application of CXCL11 as an antiviral drug, relates to the field of biological medicines, and in particular relates to a protein of an antiviral drug, and the protein as the antiviral drug can inhibit infection and replication of RSV (Respiratory Syndrome Virus). The invention also provides a technical enlightenment for taking a related host protein in a virus infection pathway as an antiviral drug research target, and an application related indication of the CXCL11 protein analogue to clinical symptoms and / or clinical indications caused by severe respiratory syncytial virus infection. The invention further provides an administration route of the CXCL11 serving as an antiviral drug, a dosage range of drug intervention and the like, and finally, the feasibility of the CXCL11 serving as the antiviral drug is further verified through drug intervention application after drug challenge in CXCL11 <- / -> mice.

According to the probiotic composition and the application of the probiotic composition in preparation of products for preventing and treating vagina inflammation, the probiotic composition composed of lactobacillus gasseri B13.52 and lactobacillus mucus B14.46 screened from vaginal secretion of healthy women can effectively inhibit growth of escherichia coli, gardnerella and prevotella; the secretion of proinflammatory factors in vaginal epithelial cells can be obviously reduced, so that an anti-inflammatory effect is achieved.

The invention belongs to the technical field of traditional Chinese medicine, and particularly relates to a medicine patch needle for preventing and treating allergic rhinitis and a preparation method and application thereof. The medicine patch needle mainly comprises a traditional Chinese medicine composition and a medicine patch thumbtack needle, and the traditional Chinese medicine composition is prepared from, by weight, 30-60 parts of radix astragali, 15-30 parts of radix angelicae sinensis, 10-25 parts of radix saposhnikoviae, 10-30 parts of rhizoma atractylodis, 10-30 parts of rhizoma acori graminei, 5-15 parts of herba asari, 10-30 parts of rhizoma chuanxiong, 10-20 parts of radix angelicae and 1-5 parts of borneol. The medicine needle patch can be used for preventing and treating allergic rhinitis, mild and lasting acupuncture stimulation is achieved on the skin part of the acupoint, the medicine can rapidly enter the acupoint along with the needle hole, in other words, the acupoint achieves the effects of harmonizing qi and blood, relieving stuffy nose and removing pathogenic qi under the dual action of the acupuncture stimulation and the medicine, and the medicine needle patch has the remarkable preventing and treating effect on the allergic rhinitis.

The invention belongs to the technical field of biological medicines, and particularly relates to application of a reagent for promoting expression of miR-15b-5p in preparation of a medicine for promoting muscle injury repair, the nucleotide sequence of the miR-15b-5p is TAGCAGCACATCGGTTTACA, and the nucleotide sequence is marked as SEQ ID NO.1. The invention also relates to application of the reagent for promoting expression of the miR-15b-5p in preparation of a medicine for promoting muscle injury repair. Through miR-15b-5p overexpression and knock-down experiments, the overexpression of the miR-15b-5p can extremely remarkably inhibit the expression of a proliferation gene of a C2C12 cell and extremely remarkably inhibit the cell activity, the miR-15b-5p can promote the apoptosis of the C2C12 cell, and meanwhile, the overexpression of the miR-15b-5p can promote the differentiation of the C2C12 cell.

The invention discloses a fish scale collagen skincare composition, a fish scale collagen cosmetic and a preparation method of the fish scale collagen skincare composition and the fish scale collagen cosmetic. The fish scale collagen skincare composition comprises 0.05-0.5 part of fish scale collagen, 0.05-0.5 part of madecassoside and 0.5-3 parts of a purslane extract. According to the invention, the fish scale collagen, madecassoside and purslane extract are combined to repair the skin barrier, calm and relieve nerves, relieve skin inflammatory response and improve sensitive skin in multiple aspects from the aspects of sensitive skin characteristics, possible mechanisms and the like instead of treating head pain and foot pain. The fish scale collagen, madecassoside and purslane extract are derived from fish scales, centella asiatica and purslane of perches respectively, are gifts given to human beings by the nature, are green and healthy, and can endow the perches with high economic value, and through the simple synergistic effect of the three components and the extremely small component addition amount, the basic state of the skin of sensitive skin is consolidated, and the skin care effect is improved. The symptoms of itching, redness and the like after the sensitive skin is stimulated are relieved.

The invention belongs to the field of bone tissue engineering, and particularly relates to a frozen 3D printing stent with synergistic signal molecules and a preparation method and application thereof.The ink composition with the synergistic signal molecules comprises a first porous carrier loaded with CO molecule prodrugs and a second porous carrier loaded with NO molecule prodrugs, the surface of the first porous carrier is coated with a first encapsulation layer, the first encapsulation layer is used for blocking the CO molecule prodrug in pores of the first porous carrier, and the first encapsulation layer can be self-degraded and release CO molecules under the condition of high oxygen activity; the surface of the second porous carrier is coated with a second encapsulation layer, the second encapsulation layer is used for blocking the NO molecule prodrug in pores of the second porous carrier, and the second encapsulation layer can be self-degraded and release NO molecules under an acidic condition. By means of the method, the stent which is complete in structure, capable of achieving timely vascularization and capable of stabilizing osteogenesis can be obtained.

The utility model discloses a circumcision fixing support which solves the technical problems that in the operation process of circumcision, a large amount of wound subcutaneous tissue is exposed, the exposure time is long, the wound infection probability is increased, postoperative wound involution is poor, wound healing is slow due to many foreign matter inflammatory reactions, and pain is caused by removal of wound fixtures. The prepuce fixing device comprises an inner ring sleeved on the coronary sulcus of the penis, an elastic thread matched with the inner ring and used for fixing the prepuce at an operation part, and a support sleeved outside a prepuce wound and used for fixing an absorbable suture at a wound suture part, the stent comprises a plurality of stent sections which are arranged on the absorbable suture in a penetrating manner. The device is simple in structure, reasonable in design, simple in surgical operation, and few in wound suture knots; less wound subcutaneous tissue is exposed, the exposure time is short, and the wound infection probability is effectively reduced; the wound is fixed by the support after operation, so that wound contracture is avoided; suture removal is completely avoided after operation, and slow wound healing caused by inflammatory reaction due to many foreign matters on the wound is avoided.

The invention discloses a medicine for treating metabolism-related fatty liver diseases by taking a JOSD2 gene or protein as a target spot, and belongs to the technical field of biological medicines. The medicine contains a substance for up-regulating JOSD2 gene expression or enhancing a JOSD2 protein function. The new functions of the JOSD2 gene and the encoded protein thereof in MAFLD are confirmed through in-vivo and in-vitro experiments for the first time, it is determined that JOSD2 is a protection factor in MAFLD, MAFLD can be treated by increasing JOSD2 expression or enhancing the activity of JOSD2, and MAFLD treatment drugs are developed by taking JOSD2 as a drug action target. The invention provides a brand new target for clinical treatment of MAFLD, and provides a new thought and a new view for innovative drug research and development of MAFLD.

The invention discloses an application of physcion in preparation of analgesic products. The emodin monomethyl ether is used as a single active component, the pain relieving mechanism of the emodin monomethyl ether is deeply discussed, and it is proved that the emodin monomethyl ether can be used as a TRPV1 activity regulator, and expression of TRPV1 is effectively inhibited. Experiments find that the physcion can effectively reduce the twisting frequency of mice caused by acid, significantly increase the pain threshold value of the mice in a hot plate experiment and a CFA inflammatory pain experiment, show an effect of enhancing the pain resistance to heat and inflammation stimulation, and meanwhile, have a significant effect of relieving metastatic bone cancer pain of the mice. The physcion shows a remarkable analgesic effect on animals, and safety or toxic and side effects are not observed.

The application discloses a postoperative auxiliary comprehensive treatment system with spatiotemporal response and a preparation method and application thereof, and relates to the fields of biology and medicine and the technical field of pharmaceutical preparations. The system comprises a temperature-sensitive hydrogel matrix, an anti-inflammatory drug dispersed in the hydrogel matrix, and nanoparticles loaded with an immunomodulator and dispersed in the hydrogel matrix. In an embodiment of the application, a postoperative auxiliary treatment comprehensive system is successfully constructed, and curcumin and MPDA encapsulating R848 are simultaneously loaded in the gel support. The small molecule curcumin is preferentially released from the gel to play an anti-inflammatory role, and R848 needs to be gradually released from the mesopore of the MPDA and the gel, so that the immune microenvironment can be improved after the anti-inflammatory curcumin promotes wound healing.

The present invention belongs to the field of biological gene engineering technology, and relates to an application of silencing USP53 gene in a drug for renal ischemia-reperfusion injury. The present invention proposes the application of a substance for silencing USP53 expression in human renal tubular epithelial cells in a drug for alleviating the inflammatory response, apoptosis and ferroptosis of renal tubular cells induced by renal ischemia-reperfusion. The above-mentioned substance for silencing USP53 expression in human renal tubular epithelial cells includes a small interfering RNA with a sequence of GUGCGGUACAUUUCUACAATT. The present invention discloses for the first time that silencing USP53 expression in renal tubular epithelial cells can improve renal ischemia-reperfusion injury, and provides a new drug design target for the treatment of renal ischemia-reperfusion injury, which has important theoretical guidance and clinical transformation application value.

The invention relates to the field of external skin care products, in particular to a peony collagen polypeptide composition for tightening and resisting wrinkles and a preparation method of the peony collagen polypeptide composition. The peony collagen polypeptide composition for tightening and resisting wrinkles is prepared from the following components in percentage by mass: 1 to 3 percent of peony root extract, 10 to 20 percent of polypeptide mixture, peony flower water, 0.3 to 0.6 percent of soluble collagen, 0.1 to 0.5 percent of ganoderma sinensis extract, 0.5 to 2 percent of white truffle fungus extract and 0.5 to 2 percent of lalang grass rhizome extract. The invention has the advantages of enhancing the firming and anti-wrinkle effects, improving the tolerance and the like.