3results about How to "Improve inflammatory response" patented technology

The invention belongs to the technical field of traditional Chinese medicine, and particularly relates to a medicine patch needle for preventing and treating allergic rhinitis and a preparation method and application thereof. The medicine patch needle mainly comprises a traditional Chinese medicine composition and a medicine patch thumbtack needle, and the traditional Chinese medicine composition is prepared from, by weight, 30-60 parts of radix astragali, 15-30 parts of radix angelicae sinensis, 10-25 parts of radix saposhnikoviae, 10-30 parts of rhizoma atractylodis, 10-30 parts of rhizoma acori graminei, 5-15 parts of herba asari, 10-30 parts of rhizoma chuanxiong, 10-20 parts of radix angelicae and 1-5 parts of borneol. The medicine needle patch can be used for preventing and treating allergic rhinitis, mild and lasting acupuncture stimulation is achieved on the skin part of the acupoint, the medicine can rapidly enter the acupoint along with the needle hole, in other words, the acupoint achieves the effects of harmonizing qi and blood, relieving stuffy nose and removing pathogenic qi under the dual action of the acupuncture stimulation and the medicine, and the medicine needle patch has the remarkable preventing and treating effect on the allergic rhinitis.

The invention belongs to the technical field of biological medicines, and particularly relates to application of a reagent for promoting expression of miR-15b-5p in preparation of a medicine for promoting muscle injury repair, the nucleotide sequence of the miR-15b-5p is TAGCAGCACATCGGTTTACA, and the nucleotide sequence is marked as SEQ ID NO.1. The invention also relates to application of the reagent for promoting expression of the miR-15b-5p in preparation of a medicine for promoting muscle injury repair. Through miR-15b-5p overexpression and knock-down experiments, the overexpression of the miR-15b-5p can extremely remarkably inhibit the expression of a proliferation gene of a C2C12 cell and extremely remarkably inhibit the cell activity, the miR-15b-5p can promote the apoptosis of the C2C12 cell, and meanwhile, the overexpression of the miR-15b-5p can promote the differentiation of the C2C12 cell.

The application discloses a postoperative auxiliary comprehensive treatment system with spatiotemporal response and a preparation method and application thereof, and relates to the fields of biology and medicine and the technical field of pharmaceutical preparations. The system comprises a temperature-sensitive hydrogel matrix, an anti-inflammatory drug dispersed in the hydrogel matrix, and nanoparticles loaded with an immunomodulator and dispersed in the hydrogel matrix. In an embodiment of the application, a postoperative auxiliary treatment comprehensive system is successfully constructed, and curcumin and MPDA encapsulating R848 are simultaneously loaded in the gel support. The small molecule curcumin is preferentially released from the gel to play an anti-inflammatory role, and R848 needs to be gradually released from the mesopore of the MPDA and the gel, so that the immune microenvironment can be improved after the anti-inflammatory curcumin promotes wound healing.