Supercharge Your Innovation With Domain-Expert AI Agents!

Novel method for realizing secreting expression of exogenous protein by using novel transfer signal

A technology for secreting and expressing flagellar proteins, applied in the direction of introducing foreign genetic material using vectors, microbe-based methods, microbes, etc., which can solve the problem of low secretion of foreign proteins

Inactive Publication Date: 2014-07-09
JIANGNAN UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, it is disappointing that the secretion of a large number of exogenous proteins is extremely low, and some cytoplasmic proteins (such as lactase LacZ, heat-resistant lactase BgaB, chloramphenicol acetyltransferase Cat) cannot be secreted outside the cell even with signal peptides

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel method for realizing secreting expression of exogenous protein by using novel transfer signal
  • Novel method for realizing secreting expression of exogenous protein by using novel transfer signal
  • Novel method for realizing secreting expression of exogenous protein by using novel transfer signal

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0023] 1. Obtaining of coding sequences of GroEL50, Eno50 and Hag50

[0024] Genomic DNA of the B. subtilis168 strain was extracted according to the instructions of the Bacterial Genome Rapid Extraction Kit. Corresponding primers were designed according to the published whole genome sequence of Bacillus subtilis168, NdeI and EcoRI restriction sites were introduced into the upstream and downstream primers, respectively, and the primers were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd. Using genomic DNA as a template, the corresponding coding sequence was amplified by PCR, and the amplified product was detected by agarose gel electrophoresis, and the size was consistent with the expectation. The polymerase used for amplification is KOD plus from Toyobo (Shanghai) Biotechnology Co., Ltd. The primer sequences are as follows, where the underline represents the restriction site.

[0025] groEL-F: ATTC CATATG GCAAAAGAAATTAAGTTTAGT

[0026] groEL50-R: CCG GAATTC ATT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of molecular biology, relates to a novel method for realizing the secreting expression of an exogenous protein in bacillus subtilis168 by using former 50 amino acids of bacillus subtilis168 molecular chaperone GroEl, enolase Eno and flagellar protein Hag, and specifically provides a novel method for realizing the secreting expression of an exogenous protein by fusing a transfer signal in the exogenous protein.

Description

technical field [0001] The invention relates to a method for realizing the secretion and expression of exogenous protein in Bacillus subtilis. More specifically, it involves the first 50 amino acids of the Bacillus subtilis molecular chaperone GroEL, the first 50 amino acids of the enolase Eno, and the first 50 amino acids of the flagellin protein Hag as transport signals to achieve the secretory expression of foreign proteins. Background technique [0002] Because Bacillus subtilis has the advantages of non-pathogenicity, strong protein secretion ability, and clear genetic characteristics. Therefore, in recent years, using Bacillus subtilis as a host to realize exogenous protein expression has attracted widespread attention. Bacillus subtilis has no outer membrane, and secreted proteins are directly released outside the cell, so Bacillus subtilis is an ideal host for secreting and expressing exogenous proteins. There are four main protein secretion pathways in Bacillus su...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/75C12N1/21C12R1/125
Inventor 陈卫王光强宋元达陈海琴
Owner JIANGNAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More