Genome editing method using attachment carrier for encoding targeted endonuclease and kit

An attachment vector, genome editing technology, applied in the field of genetic engineering, can solve the problems of reducing editing efficiency and affecting editing efficiency.

Inactive Publication Date: 2015-03-25
FUDAN UNIV
View PDF6 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

As the cells proliferate without the plasmid proliferating over time, the plasmid is diluted and editing efficiency is reduced
In addition, some cells do not get the plasmid, which will also affect the overall editing efficiency

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genome editing method using attachment carrier for encoding targeted endonuclease and kit
  • Genome editing method using attachment carrier for encoding targeted endonuclease and kit
  • Genome editing method using attachment carrier for encoding targeted endonuclease and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] Example 1: Editing of the AAVS1 locus using the EBNA1 Cas9eGFP attachment vector

[0071] The following example details the editing of the AAVS1 locus using the EBNA1 Cas9eGFP attachment vector, the sequence of the target site is 5'- AAGAAGACTAGCTGAGCTCTCGG -3' (SEQ.ID.NO.12), and the final CGG sequence is necessary for CRISPR / Cas9 editing The PAM sequence. 1 μg for 200,000 human HEK293 cells figure 1 A Transfection of the EBNA1 Cas9eGFP plasmid. After one day of incubation, selection was performed with 2 mg / ml puromycin. On the 1st, 3rd, 6th, 9th and 12th day, DNA was extracted to identify the efficiency of digestion. There is a SacI restriction site (GAGCTC) where CRISPR / Cas9 edits, which has been marked in green ( figure 2 A). After editing occurs, this site is destroyed, and the PCR product cannot be cut by SacI, so the efficiency can be identified by enzyme digestion. Depend on figure 2 B It can be seen that editing did not occur on the first day of trans...

Embodiment 2

[0072] Example 2: Editing of the EMX1 locus using the EBNA1 Cas9copGFP episomal vector

[0073] The following examples detail editing of the EMX1 locus using the EBNA1 Cas9copGFP episomal vector. use as figure 1 The EBNA1 Cas9copGFP attachment vector shown in B expresses the guide RNA for EMX1. The sequence of the target site is 5'- AGGGCTCCCATCACATCAACCGG -3' (SEQ.ID.NO.13), and the last CGG sequence is the PAM sequence necessary for CRISPR / Cas9 editing. 1 μg for 200,000 human HEK293 cells figure 1 A. The plasmid transfection. After one day of incubation, selection was performed with 2 mg / ml puromycin. On the 1st, 3rd, 6th, 9th, 12th, and 18th days, DNA was extracted to identify the enzyme digestion efficiency. There is an AgeI restriction site (ACCGGT) where CRISPR / Cas9 edits, which has been marked in green ( image 3 A). After editing occurs, this site is destroyed, and the PCR product cannot be cut by AgeI, so the efficiency can be identified by enzyme digestion. ...

Embodiment 3

[0074] Example 3: Editing of the GRIN2B locus using the EBNA1 Cas9TK episomal vector

[0075] The following examples detail editing of the GRIN2B gene using the EBNA1 Cas9TK episomal vector. use as figure 1 The EBNA1 Cas9TK episome vector shown in C expresses the guide RNA of GRIN2B. The sequence of the target site is 5'-TTCCGACGAGGTGGCCATCAAGG -3' (SEQ.ID.NO.14), and the last AGG sequence is the PAM sequence necessary for CRISPR / Cas9 editing. 1 μg for 200,000 human HEK293 cells figure 1 A. The plasmid transfection. After one day of incubation, selection was performed with 2 mg / ml puromycin. On the 1st, 3rd, 6th, 9th, 12th, 18th and 22nd days, DNA was extracted to identify the enzyme digestion efficiency. There is an MSCI restriction site (TGGCCA) where CRISPR / Cas9 edits, which has been marked in green ( Figure 4 A). After editing, this site is destroyed, and the PCR product cannot be cut by MSCI, so the efficiency can be identified by enzyme digestion. Depend on ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of bio-genetic engineering and in particular relates to a genome editing method using an attachment carrier for encoding targeted endonuclease and a kit. According to the genome editing method, the attachment carrier is utilized to express the targeted endonuclease, and the attachment carrier can realize nonconformable and stable gene expression and simultaneously expresses a screening gene; cells without getting plasmids can be removed by virtue of drug screening; and when edition is finished, a drug is removed, the cells can gradually lose the attachment carriers, and therefore, an editing cell line without containing a foreign gene is obtained. With the adoption of the genome editing method, the editing time is prolonged, and the gene editing efficiency is improved. The invention also provides the kit for editing a specific chromosome sequence of the edited cells. The genome editing method and the kit are suitable for genome edition of various eucaryotic cells.

Description

field of invention [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a genome editing method and a kit. Background technique [0002] Genome editing is a genetic manipulation technology that can modify DNA sequences at the genome level. The principle of this technology is to construct an artificial endonuclease to cut DNA at a predetermined genomic position, and the cut DNA will undergo mutations during repair by the DNA repair system in the cell, thereby achieving the purpose of targeted genome modification. The DNA repair system mainly repairs DNA double-strand breaks through two ways, namely, non-homologous end joining and homologous recombination. Through these two repair pathways, genome editing technology can achieve three genome modification goals, namely, gene knockout, introduction of specific mutations, and site-directed transgenesis. 1) Gene knockout: If you want to lose the function of a certain gene, you c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12Q1/68
Inventor王永明麦瑞天陈少波
OwnerFUDAN UNIV