Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

B-raf gene V600E mutation detection method

A mutation detection and gene technology, applied in the field of life sciences and methods, can solve problems such as insufficient sensitivity, easy contamination, limited sample size, etc.

Inactive Publication Date: 2015-05-13
JIANGSU MOLE BIOSCI
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method has the following disadvantages: the sensitivity of detection is not high enough: if the content of the mutated gene accounts for less than 10% of the total amount of genomic DNA, the existence of the mutated sample cannot be detected by direct sequencing; High requirements; non-closed-tube operation involves the operation after PCR amplification, so it is easy to be contaminated, resulting in unsatisfactory results; the interpretation of sequencing results is highly subjective; the number of samples tested in one experiment is limited, at most 8-24 example

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • B-raf gene V600E mutation detection method
  • B-raf gene V600E mutation detection method
  • B-raf gene V600E mutation detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment example

[0019] Tumor tissue samples suspected of having the V600E mutation of the B-raf gene were detected.

[0020] 1. Design and synthesize the primer probes as shown in Table 1.

[0021] Table 1

[0022] Primer name

sequence

F primer

ATGAAGACTCACAGTA

R primer

ATCCAGACAACTGTTCAAACTGA

General probe

TTTTGGTCTAGCTACAGTGAA-BHQ

T probe

FAM-ATCTCGATGGAGTGGG-PO4

A probe

TET-ATCTCGAAGGAGTGGG-PO4

[0023] 2. DNA extraction: use a commercial kit to extract and purify the DNA in the tissue.

[0024] 3. Amplification

[0025] 3.1 PCR amplification system

[0026] Prepare the PCR reaction solution as follows.

[0027] Component

volume

2×PCR Buffer

10ul

F primer

1ul

R primer

1ul

General probe

1ul

T probe

0.5ul

A probe

0.5ul

Taq enzyme

1ul

h 2 o

5ul

DNA template

5ul

Total

25ul

[0028] 3....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a B-raf gene V600E mutation detection method, and belongs to the field of life science and technology, wherein the method can be used for detecting whether a particular nucleotide variation exists in the B-raf gene in the DNA sample isolated from the patient body in vivo. The method comprises a polymerase chain reaction, wherein the reaction system contains a specific forward primer, a specific downstream primer, and a set of probes treated according to a specific method, a single-stranded nucleotide hybridization and melting process is performed under specific conditions, and a fluorescence quantitative PCR instrument is utilized to collect the fluorescence signal during the melting so as to determine the presence or absence of the variation.

Description

Technical field: [0001] The invention relates to a method for diagnosing the V600E mutation of the B-raf gene. The method can detect whether there is a specific nucleotide variation in the B-raf gene in a DNA sample isolated from a patient. It belongs to the field of life science and technology. Background technique: [0002] The B-raf gene is an oncogene, which belongs to the RAF family with the ARAF and RAF1 (CRAF) genes. It is located at 7q34 and is about 190kb long. The B-raf protein translated by it consists of 783 amino acids and has three conserved regions, CR1, CR2 and CR3. B-raf protein is a member of serine-threonine protein kinase raf / mil family and an important regulator in the Ras-Raf-MEK-ERK signaling pathway. The B-raf protein is located at the entrance of the MAPK / ERK pathway, and it connects receptors and RAS proteins on the cell surface with transcription factors in the nucleus through MEK and ERK, thereby regulating cell differentiation and division. Wh...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6858C12Q2535/137C12Q2561/101
Inventor 孙益乐
Owner JIANGSU MOLE BIOSCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products