Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Novel gene quantitative detection method composition, kit and method thereof

A detection method and composition technology, applied in biochemical equipment and methods, microbial measurement/testing, recombinant DNA technology, etc., can solve problems such as expensive instruments and reagents, difficulty in meeting the detection needs of on-site or grassroots laboratories, etc.

Inactive Publication Date: 2018-03-16
CHINESE ACAD OF INSPECTION & QUARANTINE
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although this type of technology is sensitive and accurate, it needs to rely on expensive instruments and reagents, and it is difficult to meet the detection needs of on-site or grassroots laboratories

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel gene quantitative detection method composition, kit and method thereof
  • Novel gene quantitative detection method composition, kit and method thereof
  • Novel gene quantitative detection method composition, kit and method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033]This example verifies the specificity, sensitivity and linear correlation of pig and bovine specific padlock probes.

[0034] The probe sequence was synthesized by IDT Biological Co., Ltd. of the United States. The 5' end of the padlock lock probe was connected to a phosphate, the 5' end of the capture probe was labeled with biotin, and the 5' end of the detection probe was labeled with HRPMT. See the table below for the specific sequence.

[0035] name

sequence

illustrate

GHpadlock1cow probe

5' AGCTTTGGGCTTTAGATCCTCAATGCTGCTGCTG TACTACCAATAGAGGTACAGTGAATGCGAGTCCGTCTCGATGGATGTGTTCAG 3' (SEQ ID No. 1)

Phosphate group attached to the 5' end

GHpadlock1pig probe

5' AACCTTGGGCTTTGCTTCTAATCCTCAATGCTGCTGCTTTACTAGTGCTGGATGATCGTCCCTTCTCGGATGGGGCACC 3' (SEQ ID No. 2)

Phosphate group attached to the 5' end

Cytbpadlock1cow probe

5' ATCCGATACATACACGCCAAGAAATCCTCAATGCTGCTAGGTTCCAGTGAATGCGAGTCCGTCTCAGAAAGAACTACGGCTGAATC 3' (SEQ I...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a novel object gene quantitative detection method padlock-RCA-ELISA method. The invention also relates to an oligonucleotide probe composition for relative quantitative detection on different animal source growth hormone genes in animal tissues (pig and cattle) and relative quantitative detection (pig and cattle) on mitochondrial cytochrome b gene by using the method. Theinvention also relates to a padlock-RCA-ELISA kit containing the composition. By using the method, quantitative detection can be carried out on a target gene in a simple, rapid, and accurate mode.

Description

technical field [0001] The invention belongs to the field of biotechnology. Specifically, the invention relates to a novel gene quantitative detection method-padlock-RCA-ELISA method, and using the method to perform relative quantification of growth hormone genes from different animal sources in animal tissues (pig and bovine ) and oligonucleotide probe compositions for relative quantification (porcine and bovine) of mitochondrial cytochrome genes. It also relates to a padlock-RCA-ELISA kit comprising said composition. Background technique [0002] Gene quantitative detection is widely used in medical diagnosis, infectious pathogen monitoring, forensic medicine, and food safety. The current common method is real-time fluorescent quantitative PCR, and the latest technology room digital PCR. These methods all need to be based on PCR technology, and the signal detection is realized by amplifying the target gene in the molecular copy number. Although this type of technology i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6851C12N15/11
CPCC12Q1/6851C12Q2531/125
Inventor 吴亚君陈磊陈颖刘鸣畅杨艳歌
Owner CHINESE ACAD OF INSPECTION & QUARANTINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com