Unlock instant, AI-driven research and patent intelligence for your innovation.

Ovine babesia universal detection kit

A general-purpose detection technology for Babesia sheep, applied in the field of general-purpose kits for the detection of Babesia sheep antibodies, can solve the problems of only specific detection, low efficiency, cumbersome operation, etc., and achieve easy standardization, simple operation, cost saving effect

Inactive Publication Date: 2019-08-02
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The indirect ELISA (Guan et al., 2010) established with the merozoite soluble antigen of Babesia moseni strain Lintan in vitro can only detect the Lintan strain and Tianzhu strain of Babesia moseni, but not the to the Hebei strain and the Ningxian strain of Babesia moiii; the indirect ELISA (Guan et al., 2012) established with the merozoite soluble antigen of the Babesia unspecified Xinjiang strain cultured in vitro can only specifically detect Babesia An unspecified Xinjiang strain of Babesia; the indirect ELISA established with BspXJ-rRAP-1 as the target antigen (patent application number: 201610890348.1) can only specifically detect the unspecified Xinjiang strain of Babesia; BmLT-rRAP-1 is used as the target antigen The established indirect ELISA (Niu et al., 2016) can only detect the Lintan strain, Tianzhu strain, and Ningxian strain of Babesia moseni, but cannot detect the Hebei strain of Babesia moseni
The existing technology that can only specifically detect Babesia is limited in practical applications. In practical applications, it is necessary to perform at least two detections of different insect species on the same sample, making it cumbersome and inefficient to operate. It has become very difficult to carry out large-scale epidemiological investigations and diagnostic testing of clinical cases in production practice, and it is even impossible to implement them

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Ovine babesia universal detection kit
  • Ovine babesia universal detection kit
  • Ovine babesia universal detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0021] The present invention is illustrated below in conjunction with examples.

[0022] 1. Obtaining the target protein

[0023] 1. Acquisition of the target gene (two artificial sequences)

[0024] SEQ ID No. 1: Bsp-AMA1-F

[0025] 5' CCGGAATTCAGGTTTGACATTCCTAGGGT 3'

[0026] SEQ ID No. 2: Bsp-AMA1-R

[0027] 5' ATTTGCGGCCGC GTACTTAGTTAGCTTGTCTG 3', the pre-obtained target fragment size is 393bp (bases 288-681 of the AMA1 nucleotide sequence)

[0028] 2. Construction of recombinant expression vector

[0029] Using the cDNA of the unspecified Xinjiang strain of Babesia ovis preserved in the laboratory as a template for amplification, a 50 μL PCR reaction system was used. The reaction conditions were pre-denaturation at 94°C for 3 minutes, followed by 1 minute at 94°C, 1 minute at 56°C, and 30 seconds at 72°C. 34 cycles, 72°C extension for 10 min. PCR amplification products were identified by agarose gel electrophoresis. PCR products identified as positive were purified a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses an ovine babesia antibody universal detection kit. The ovine babesia universal detection kit comprises at least a substrate coating of the truncated ovine babesia AMA1recombinant antigen. According to the technical scheme of the present invention, the AMAl protein secreted by the microbe of the ovine babesia is taken as a detection marker, the target gene is expressed in the Escherichia coli to purify the protein, and an indirect ELISA kit is established by using the obtained recombinant antigen for detecting or diagnosing the ovine babesiosis; and the technical scheme of the present invention makes up for the deficiencies of the prior art, a universal detection kit capable of detecting the infection of the unidentified species of the ovine babesia and the6 strains of the babesia serrate is established for the first time, and the universal detection kit can be used for qualitative testing the ovine babesia antibody and has the advantages of simple operations, a cost-saving effect, a high throughput, easy standardization and the like.

Description

technical field [0001] The invention relates to a general detection kit for parasites, specifically, the invention relates to a general detection kit for the detection of Babesia sheep antibodies. Background technique [0002] Babesia is a kind of parasitic animal and human erythrocytes, belonging to Apicomplexa (Apicomplexa), Sporozoea (Sporozoea), Piroplasmida (Piroplasmida), Babesiidae (Babesiidae), Babesia ( Tick-borne blood protozoa of Babesia). So far, there are more than 100 species of Babesia reported worldwide, but the currently reported and named Babesia infecting sheep is mainly Babesia mosoni ( B. motasi ), Babesia sheep ( B.ovis ) and Babesia crassa ( B. crassa ) three kinds. There are two main types of Babesia that infect sheep in my country, namely Babesia mosoni ( Babesia. Bm) and Babesia unspecified ( Babesia sp. Bsp) (Guan et al., 2002,2009; Liu et al., 2007; Niu et al., 2009). Babesiosis (babesiosis) is a kind of tick-borne blood parasitic dis...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/68G01N33/58C07K14/44C12N15/70C12N15/30
CPCC07K14/44C12N15/70G01N33/581G01N33/68
Inventor 关贵全徐建林王锦明刘军龙刘爱红李有全罗建勋殷宏
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More