Signal amplification magnetic bead technology system for nucleic acid detection based on the CRISPR technology and application thereof

A signal amplification and technical system technology, applied in the direction of microbial determination/inspection, measuring devices, biochemical equipment and methods, etc., can solve problems such as missed detection and false negatives

Active Publication Date: 2020-10-30
SUZHOU VERTEX BIOLOGICAL PHARM CO LTD
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0018] Cas12b, Cas13b, and Csm6 are similar in principle to the above-mentioned Cas protein, and will not be described again; but whether it is Cas13a, Cas12a, Cas14, Cas12b, Cas13b or Csm6, its detection sensitivity to nucleic acid can only reach aM (10 -18 M) Concentration level (that is, 1000-10000copies / mL), when the concentration of the molecule to be detected is lower than 1000copies / mL, it is easy to miss the detection and cause false negative

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Signal amplification magnetic bead technology system for nucleic acid detection based on the CRISPR technology and application thereof
  • Signal amplification magnetic bead technology system for nucleic acid detection based on the CRISPR technology and application thereof
  • Signal amplification magnetic bead technology system for nucleic acid detection based on the CRISPR technology and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Taking the coronavirus RNA detection method constructed by the Cas12a-based signal amplification magnetic bead technology system as an example to illustrate the specific technical scheme:

[0064] 1. Test sample: fake virus (reference substance)

[0065] Product name: COVID-19-pseudovirus (2019-nCOV pseudovirus)

[0066] Product number: 11900ES08 (Shanghai Yisheng Biotechnology Co., Ltd.)

[0067] Specification: 5×1mL

[0068] Target value = 1×10 8 copies / mL

[0069] 2. The sequence to be detected:

[0070] GGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCAGTCAGCTGATGCACAATCGTTTTTAAACGGGTTTGCGGTGTAAGTGCAGCCCGTCTTACACCGTGCGGCACAGGCACTAGTACTGATGTCGTATACAGGGCTTTTGACATC

[0071] 3. Isothermal amplification primer synthesis

[0072] RPA-F primer: GGTTATGGCTGTAGTTGTGATCAACTCCGC

[0073] RPA-R primer: GATGTCAAAAAGCCCTGTATACGACATCAGTAC

[0074] 4. Design and synthesis of crRNA

[0075] Design and synthesize crRNA sequence: AGACGGGCTGCACTTACACCG,

[0076] 5. Design and prepa...

Embodiment 2

[0128] Taking the Salmonella DNA detection method constructed by the Cas13a-based signal amplification magnetic bead technology system as an example to illustrate the specific technical scheme:

[0129] 1. Test sample: Salmonella standard plasmid (reference substance)

[0130]Salmonella standard plasmid preparation process: the Salmonella inv A gene (GenBank: KJ718885.1) was selected as a specific detection fragment, and the 287bp inv A gene fragment was connected to the pMD19-T vector to construct a standard plasmid.

[0131] Specification: 10×1mL

[0132] target value = 5 x 10 10 copies / mL

[0133] 2. The sequence to be detected:

[0134] TGTGAAATTATCGCCACGTTCGGGCAATTCGGTATTGACGATAGCCTGGCGGTGGGTTTTGTTGTCTTCTCTATTGTCACCGTGGTCCAGTTTATCGTTATTACCAAAGGTTCAGAACGCGTCGCGGAAGTCGCGGCCCGATTTTCTCTGGATGGTATGCCCGGTAAACAGATGAGTATTGATGCCGATTTGAAGGCCGGTATTATTGATGCGGATGCCGCGCGCGAACGGCGAAGCGTACTGGAAAGAGAAAGCCAGCTTTACGGTTCCTTTGACGGTGCGATGAA

[0135] 3. Design and synthesis of isothermal amp...

Embodiment 3

[0190] Taking the detection method of whether Schistosoma mansoni is contained in the water sample in the epidemic area constructed by the signal amplification magnetic bead technology system based on Cas12a as an example to illustrate the specific technical scheme:

[0191] 1. The samples to be tested are: water samples confirmed to be slightly polluted by Schistosoma mansoni (A), water samples confirmed to be moderately polluted by Schistosoma mansoni (B), water samples confirmed not to contain Schistosoma mansoni ( C), samples of Schistosoma mansoni (D)

[0192] 2. DNA extraction of samples to be tested: four DNA samples of A, B, C, and D were extracted;

[0193] 3. The sequence to be detected

[0194] CCTTCGGGCATTGCTGAGTGTGGTCGGTTTGTTACTAGCTTCGGCTGGTCGGCTGATGGCTTGGTTTTGTCACGTCGGCGGTTGCGTGTGTGGTTTGCATTGGGCCAATAGTCTGTGGTGTAGTGGTAGACGATCCACCTGACCCGTCTTGAAACACGGACCAAAGGAGTTTAACATGTGCGCGAGTCATTGGGGTGTAGTAGTAGTCAGC

[0195] 4. Design and synthesis of isothermal amplification p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a report magnetic bead. The report magnetic bead comprises a magnetic bead, nucleotide and an enzyme with high catalytic activity which are linked. The invention further discloses a signal amplification magnetic bead technical system for nucleic acid detection based on the CRISPR technology, and a construction method and application of the report magnetic bead. By introducing the report magnetic bead, the sensitivity of the signal amplification magnetic bead technology system is improved from the aM (1000-10000 copies / mL) concentration level to the zM (1-10 copies / mL) concentration level.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a signal amplification magnetic bead technology system for nucleic acid detection based on CRISPR technology and its application. Background technique [0002] CRISPR nucleic acid detection technology can be used for the detection of DNA or RNA molecules from plants, animals, microorganisms, viruses and other sources. At present, the proteins used for CRISPR nucleic acid detection include Cas13a, Cas12a, Cas14, Cas12b, Cas13b, Csm6 and other Cas proteins with bypass nucleic acid cleavage activity. [0003] Cas13a protein molecule: recognizes specific single-stranded RNA molecules, activates bypass nucleic acid cleavage activity, and non-specifically cuts any single-stranded RNA molecule. [0004] The crRNA nucleic acid molecule can combine with the Cas13a protein molecule to form a crRNA-Cas13a complex. When the crRNA nucleic acid molecule matches the target RNA molecul...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/682C12Q1/6844C12Q1/70C12Q1/40
CPCC12Q1/682C12Q1/6844C12Q1/701C12Q1/40G01N2333/938C12Q2531/119C12Q2521/327C12Q2563/107C12Q2563/125C12Q2563/143C12Q2563/149C12Q2565/519
Inventor郑敦武
OwnerSUZHOU VERTEX BIOLOGICAL PHARM CO LTD