Paired-end library index composition and its application in mgi sequencing platform

A composition and tag sequence technology, applied in the field of plasma DNA library construction, can solve problems such as sample crosstalk

Active Publication Date: 2021-06-15
NANODIGMBIO (NANJING) BIOTECHNOLOGY CO LTD
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The main purpose of the present invention is to provide a paired-end tag amplification primer composition and its application in the MGI sequencing platform to solve the problem that the existing MGI sequencing platform uses single-end tagging library prone to sample crosstalk

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Paired-end library index composition and its application in mgi sequencing platform
  • Paired-end library index composition and its application in mgi sequencing platform
  • Paired-end library index composition and its application in mgi sequencing platform

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0081] Example 1 Database construction scheme one and scheme two

[0082] Specific steps: refer to NadPrep TM The only difference in the manual of the DNA library construction kit (for MGI) (201909Version2.0) is the difference in the sequence of the bubble adapter and the sequence of the amplification primer

[0083] (1) Option 1:

[0084] Bubble linker sequence:

[0085] Linker sequence 1 shown in SEQ ID NO:769 and linker sequence 2 shown in SEQ ID NO:770:

[0086] SEQ ID NO: 769: (31bp) / phos / agtcggaggccaagcggtcttaggaagacaa;

[0087] SEQ ID NO: 770 (40bp): ttgtcttcctaacaggaacgacatggctacgatccgact*t.

[0088] Amplification primer 1 shown in SEQ ID NO:771 and amplification primer 2 shown in SEQ ID NO:772:

[0089] SEQ ID NO:771: (64bp)

[0090] / phos / ctctcagtacgtcagcagttnnnnnnnnnncaactccttggctcacagaacgacatggctacga; Wherein, the sequence ( / phos / ctctcagtacgtcagcagtt) before nnnnnnnnnn is recorded as SEQ ID NO:793, and the sequence after nnnnnnnnnn (caactccttggctcacagaac gac...

Embodiment 2

[0120] Example 2 12 sample mixed data split comparisons with 4 balance and 8 balance

[0121] The double-ended labeling scheme can effectively remove the crosstalk between samples (also known as label skipping), but since splitting the data requires correct labels at both ends, the valid sequencing data can be split, so the label balance requirements when using the machine Stricter than single-ended labeling requirements. This application optimizes two sets of schemes of 4 balance and 8 balance. In this embodiment, 4 balance and 8 balance are used respectively, and 12 library mixed samples are tested on the computer to detect the effective resolution rate of each sample by the two sets of schemes. The specific experimental steps and information are as follows:

[0122] Specific steps: refer to NadPrep for the steps of building a library TM Instructions for DNA Library Construction Kit (for MGI) (201909Version2.0), the only difference is that the single-end index adapter is c...

Embodiment 3

[0133] In order to ensure the performance difference between the 8-balanced 48-group tag sequence of this application and the 8-balanced 12-group tag sequence provided by Huada Manufacturing, the 8-balanced 48-group tag sequence of this application was designed in consideration of the 8-balanced 48-group tag sequence provided by Huada Manufacturing. The compatibility of the balanced 12 sets of tag sequences when used on the machine, therefore, there are 3 bases in any two sequences between the 8 balanced 48 sets of tag sequences of this application and the 8 balanced 12 sets of tag sequences provided by Huada Manufacturing base difference.

[0134] Additionally, other major points of difference are:

[0135] 1. The base composition of the tag sequence of the present invention is more balanced, with a GC% content of 40%-60%; while MGI’s GC% content is 20%-80%;

[0136] 2. The tag sequences of the present invention have been calculated for matching with the linker sequences of ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a double-end index amplification primer composition and its application in the MGI sequencing platform. Wherein, the paired-end library tag composition includes: multiple 5'-end library tags and multiple 3'-end library tags, multiple 5'-end library tags are all the same length, and multiple 3'-end library tags are all the same length , and in the paired-end library index composition, the number of occurrences of each base at the same position is the same. Using optimized double-end library tags for data splitting can solve the problem of crosstalk caused by synthesis, experimental links and on-machine sequencing. And control the length of the library tags at each 5' end is the same, the length of the library tags at the 3' end is also the same, and the number of occurrences of each base at the same position is the same, and a double-ended library tag with good base balance can be obtained. When these multiple libraries are mixed and sequenced on the machine, the reading accuracy of the paired-end tags of each library is high, thereby improving the effective resolution rate of the library.

Description

technical field [0001] The invention relates to the field of plasma DNA library construction, in particular to a double-end tag amplification primer composition and its application in an MGI sequencing platform. Background technique [0002] In the sequencing process of the MGI high-throughput sequencer, in order to achieve more sample sequencing, each sample needs to be tagged and sequenced with a different index sequence (Index) and then split. However, the current MGI sequencing platform basically uses libraries with single-end tags. Due to the natural defects of the single-end label (Index), it is easy to cause crosstalk between samples. Due to the contamination of index adapters or primers in the synthesis, experimental operation and sequencing, mutual crosstalk is inevitable, so it is necessary to solve the low-frequency mutual crosstalk between samples. At present, the best way is to use double-ended tags To solve the problem, the double-ended labeling method can ef...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C40B70/00C12Q1/6806C12N15/10C12N15/11C40B50/06
CPCC40B70/00C12Q1/6806C12N15/1093C40B50/06C12Q2525/191C12Q2535/122C12Q1/6869C12Q2525/161C12Q2531/113C12Q2537/143C12N15/1065C12N15/1068
Inventor汪彪胡玉刚郑文莉吴强
OwnerNANODIGMBIO (NANJING) BIOTECHNOLOGY CO LTD