Sequencing method and kit for improving bar code splitting ratio
A barcode and kit technology, which is applied in the field of sequencing, can solve the problem that the sequence of some inserted fragments cannot be split out, and achieve the effect of improving the splitting rate.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0063] 1. Equipment:
[0064] The equipment used in this example includes: MGISEQ-2000RS sequencer, MGISEQ-2000RS sequencing reagent slide (715nm), mini loader, PCR machine, PCR eight-tube, a set of Eppendorf pipettes, Effendorf high-speed centrifuge.
[0065] 2. Reagents:
[0066] 1) Primer sequence:
[0067] Occupation primer sequence: AAGTCGGAGGCCAAGCGGTCTTAGGAAGA-ddC (SEQ ID NO: 1, the blocking method is that the 3' end of the primer is blocked by dideoxycytosine nucleotides, and the recovery method is to remove the occupancy primer through formamide denaturation, and Re-hybridize a barcoded sequencing primer with a hydroxyl group at the 3' end).
[0068] Insert sequencing primer sequence: GCTCACAGAACGACATGGCTACGATCCGACTT (SEQ ID NO: 2).
[0069] 2) The reagents used in this example are shown in Table 1 below:
[0070] Table 1
[0071]
[0072] 3. Reagent preparation:
[0073] 1) Dissolution of primer sequence:
[0074] Centrifuge the 1.5 ml centrifuge tube conta...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com