Check patentability & draft patents in minutes with Patsnap Eureka AI!

Sequencing method and kit for improving bar code splitting ratio

A barcode and kit technology, which is applied in the field of sequencing, can solve the problem that the sequence of some inserted fragments cannot be split out, and achieve the effect of improving the splitting rate.

Pending Publication Date: 2020-12-11
MGI TECH CO LTD
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The present invention provides a sequencing method and a kit for improving the barcode splitting rate. Under the premise of not affecting the quality of the single-end sequencing data, it solves the problem that the read length of the single-end sequencing exceeds the length of the insert, which causes some of the inserts to be too short. Split out the problem

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sequencing method and kit for improving bar code splitting ratio
  • Sequencing method and kit for improving bar code splitting ratio
  • Sequencing method and kit for improving bar code splitting ratio

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] 1. Equipment:

[0064] The equipment used in this example includes: MGISEQ-2000RS sequencer, MGISEQ-2000RS sequencing reagent slide (715nm), mini loader, PCR machine, PCR eight-tube, a set of Eppendorf pipettes, Effendorf high-speed centrifuge.

[0065] 2. Reagents:

[0066] 1) Primer sequence:

[0067] Occupation primer sequence: AAGTCGGAGGCCAAGCGGTCTTAGGAAGA-ddC (SEQ ID NO: 1, the blocking method is that the 3' end of the primer is blocked by dideoxycytosine nucleotides, and the recovery method is to remove the occupancy primer through formamide denaturation, and Re-hybridize a barcoded sequencing primer with a hydroxyl group at the 3' end).

[0068] Insert sequencing primer sequence: GCTCACAGAACGACATGGCTACGATCCGACTT (SEQ ID NO: 2).

[0069] 2) The reagents used in this example are shown in Table 1 below:

[0070] Table 1

[0071]

[0072] 3. Reagent preparation:

[0073] 1) Dissolution of primer sequence:

[0074] Centrifuge the 1.5 ml centrifuge tube conta...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a sequencing method and kit for improving the bar code splitting ratio. The method comprises the following steps of: providing an insert fragment sequencing primer, a blockedplaceholder primer and a template to be detected, wherein the 3' end of the placeholder primer is blocked and cannot extend; furthermore, the hybridization position of the placeholder primer on the template to be detected is located at the hybridization position of a bar code sequencing primer or a downstream region thereof; hybridizing the insert fragment sequencing primer and the placeholder primer onto the template to be detected, and sequencing an insert fragment; and, removing the placeholder primer and hybridizing with the bar code sequencing primer after sequencing of the insert fragment is completed and the 3' hydroxyl end of a sequencing product is blocked, or recovering the 3' end of the placeholder primer into a 3' hydroxyl group as the bar code sequencing primer to perform barcode sequencing. According to the method disclosed by the invention, on the premise of not influencing the quality of single-ended sequencing data, the problem that a part of sequences with too shortinsert fragments cannot be split due to the fact that the single-ended sequencing read length exceeds the length of the insert fragments is solved.

Description

technical field [0001] The invention relates to the technical field of sequencing, in particular to a sequencing method and a kit for improving the barcode splitting rate. Background technique [0002] Existing next-generation sequencing methods include insert sequencing and barcode sequencing. Inserts can be sequenced first, and then barcodes can be sequenced; or barcodes can be sequenced first, and then inserts can be measured. [0003] There is a problem with the method of sequencing inserts first, and then sequencing barcodes: the length of inserts in the library is diffusely distributed. When the inserts need to be read through, the adapters and barcodes of the shorter inserts will be detected. However, the sequencing primers that lead to the barcode cannot be combined with the sequence to be tested and cannot be sequenced, so that the part of the test to be tested that is too short in the inserted fragment cannot be split out and is filtered out. [0004] However, if ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6869
CPCC12Q1/6869C12Q2563/185C12Q2535/122
Inventor 王静静罗银玲龚梅花李计广徐崇钧蒋慧
Owner MGI TECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More