Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit for detecting copy number variation of gene DNM2

A gene copy number, Q-DNM2-LF technology, applied in the field of biomedical detection, can solve the problems of high sensitivity, unsuitable for high-throughput detection, etc., and achieve the effect of low pre-experimental cost

Pending Publication Date: 2021-03-19
CHANGSHA KINGMED MEDICAL DIAGNOSTICS INST
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method is simple and easy to operate, with high sensitivity, good repeatability, fast speed and less pollution, but it is not suitable for high-throughput detection of large samples

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting copy number variation of gene DNM2
  • Kit for detecting copy number variation of gene DNM2
  • Kit for detecting copy number variation of gene DNM2

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0041] 1. Primer test

[0042]1) Linear DNA preparation (Table 1): gradiently dilute the standard Human genetic DNA (253ng / ul), take 13ul and add 37ul ddH 2 O, vortex, micro separation, the concentration is 66ng / uL.

[0043] Then 10-fold serial dilution, take 20ul and add to 180ul ddH 2 In O, it is necessary to fully vortex and mix each time before proceeding to the next gradient dilution.

[0044] Table 1

[0045]

[0046] 2) Experimental system (Table 2)

[0047] Table 2

[0048]

[0049] 3) Amplification program (Table 3)

[0050] table 3

[0051]

[0052] 4) Analysis of results

[0053] ABI7500 settings:

[0054] Experiment Prop selects Quantutation–Relative Standard Curve and SYBRGreen Reagents.

[0055] The result is as follows:

[0056] Primer DNM2-L: the amplification efficiency of the primer is 92.86%, and the peak of the melting curve is single;

[0057] Primer DNM2-M: The amplification efficiency of the primer is 95.1%, and the peak of the meltin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit for detecting copy number variation of a gene DNM2. The kit comprises the following primer pairs of Q-DNM2-LF: GGAGCAACGGCTACAGACCGC; Q-DNM2-LR: CTCTTCCATCCCGCGGTTGGGC; Q-DNM2-MF: GGACGCCTTCAGCTCCATGCGC; Q-DNM2-MR: CGGCCCACGAAGTTCTCCAGCTGC; Q-DNM2-RF: CCAAGGTCTTCTTGGGCACGG; and Q-DNM2-RR: CCACTGGGCCAGGCTTGCCGCACG. The kit is simple, rapid, low in pre-experiment cost and suitable for small-batch detection and verification.

Description

technical field [0001] The invention belongs to the technical field of biomedical detection, and in particular relates to a kit for detecting DNM2 gene copy number variation. Background technique [0002] DNM2 (dynamin 2) gene is a transcription factor involved in various cellular functions, such as endocytosis, phagosome formation, intracellular transport, interaction with actin and microtubule network, and promotion of apoptosis. Pathogenic variants in the DNM2 gene cause centronuclear myopathy (CNM) type 1 and Charcot-Marie-Tooth disease, as well as fatal congenital contracture syndrome. Studies have found that the relationship between CNM and DNM2 gene mutation itself is not obvious, but is closely related to its mRNA expression level, and reducing its expression level can significantly improve the lesion. This phenomenon suggests that there is a unique molecular mechanism for the pathogenesis of CNM. Previous studies have found that DNM2 contains multiple intragenic mi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883C12Q1/6858C12N15/11
CPCC12Q1/6883C12Q1/6858C12Q2600/156C12Q2600/166C12Q2531/113C12Q2545/101C12Q2537/16C12Q2563/107
Inventor 余艳李慧源周梅华代冰李淼唐春燕
Owner CHANGSHA KINGMED MEDICAL DIAGNOSTICS INST
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More