Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer composition for detecting TERT promoter methylation and application thereof

A primer composition and a technology for detecting primers, which are applied in the determination/inspection of microorganisms, recombinant DNA technology, biochemical equipment and methods, etc., to achieve the effect of wide application range, strong feasibility and not easy to degrade

Pending Publication Date: 2021-04-16
HUNAN LINGKANG MEDICAL TECH CO LTD
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no report on the relationship between the methylation of the TERT gene promoter region and renal cancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer composition for detecting TERT promoter methylation and application thereof
  • Primer composition for detecting TERT promoter methylation and application thereof
  • Primer composition for detecting TERT promoter methylation and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 Methylation site on TERT gene

[0036] The present invention is based on the Illumina 450K chip of TCGA kidney cancer patients, and analyzes the difference in methylation degree according to the methylation sites on the TERT gene in tumor tissue and normal tissue, and it is identified that cg11625005 is a site with a significant difference in methylation degree. Located 554bp upstream of the promoter of the TERT gene. figure 1 It is the relationship between the methylation level of TERT cg11625005 site and the stage, grade, survival and prognosis of renal cancer patients.

[0037] Based on the data of TCGA kidney cancer patients, the present invention finds for the first time that the methylation level of TERT cg11625005 site is closely related to the stage, grade, survival and prognosis of kidney cancer patients.

Embodiment 2

[0038] Example 2 Kit

[0039] Primers were synthesized by SangonBiotech, and the specific primer sequences are as follows:

[0040] cg11625005-F (SEQ ID NO: 1): GGGTTTGTGTTAAGGAGTTTAAG;

[0041] cg11625005-Rbio (SEQ ID NO: 2): AAAACCCAAAAACTACCTCCA;

[0042] cg11625005-S (SEQ ID NO: 3): GTGTTAGTTTAGGGAGTAATG.

Embodiment 3

[0043] Embodiment 3 TERT gene methylation detection

[0044] 1. Extract DNA samples from tumor tissue and normal tissue (or patient's body fluids, such as blood, urine, etc.) according to the commercial genome extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., Cat. No. DP304).

[0045] 2. Take 0.5-1μg DNA sample and use methylation transformation kit EZ DNAMethylation-Gold TM Kit (ZYMO, D5006) for transformation and purification.

[0046] 2.1 Sample homogenization: use a NanoDrop ND-2000 spectrophotometer to determine that the sample concentration is greater than 50ng / μL, and the total amount of the sample is greater than 500ng.

[0047] 2.2 Reagent preparation:

[0048] Reagent 1: add 900 μL H 2 O, 300 μL M-Dilution Buffer, 50 μL M-Dissolving Buffer (into CT Conversion Reagent tube, shake at room temperature for 10 min.

[0049] Reagent 2: Add 96mL of 100% ethanol to M-Wash Buffer.

[0050] 2.3 According to Table 1, prepare the bisulfite conversion reac...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a TERT promoter methylation detection primer composition and application of the TERT promoter methylation detection primer composition in kidney cancer detection. According to the primer composition, the methylation level of the cg11625005 site of the TERT promoter can be detected through a pyrosequencing technology, and pathological staging grading is further carried out on the kidney cancer. The TERT promoter provided by the invention is high in methylation level detection sensitivity and accuracy, and has important guiding significance for early detection, prognosis and risk assessment of kidney cancer.

Description

technical field [0001] The invention relates to the technical field of molecular biological detection, in particular to a primer composition for detection of TERT promoter methylation and its application in the detection of kidney cancer. Background technique [0002] Renal cancer is a malignant tumor originating from the renal parenchyma. The high-incidence age group of renal cancer is 50-70 years old, accounting for 2-3% of adult malignant tumors, ranking second in the incidence of malignant tumors of the urinary system in my country, second only to Bladder cancer, its incidence has gradually increased in recent years. According to research, the 5-year survival rates of patients with different risks after renal cancer surgery are different. Low-risk patients top the list with a rate of 90%, while high-risk patients only have 42%, and intermediate-risk patients have a rate of 62%, which is not optimistic. Due to various factors, the survival rate of RCC patients in my count...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6886C12N15/11
CPCC12N15/11C12Q1/6886C12Q1/68
Inventor 邓务国龙谦肖比苍
Owner HUNAN LINGKANG MEDICAL TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products