QSOX1 as an Anti-Neoplastic Drug Target

a technology of antineoplastic drugs and qsox1, which is applied in the field of qsox1 as an antineoplastic drug target, can solve problems such as unresectable tumors, and achieve the effect of limiting tumor metastasis

Inactive Publication Date: 2014-05-22
ARIZONA STATE UNIVERSITY
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This patent describes methods for treating tumors by inhibiting the expression and activity of a protein called quiescin sulfhydryl oxidase 1 (QSOX1). The inhibitor can be an antibody, an aptamer, an antisense oligonucleotide, a siRNA, or a shRNA. The invention is particularly useful for treating pancreatic tumors, where QSOX1 is over-expressed compared to control. The treatment method helps to limit tumor metastasis.

Problems solved by technology

It is often detected in stage III resulting in an unresectable tumor at the time of diagnosis.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • QSOX1 as an Anti-Neoplastic Drug Target
  • QSOX1 as an Anti-Neoplastic Drug Target
  • QSOX1 as an Anti-Neoplastic Drug Target

Examples

Experimental program
Comparison scheme
Effect test

example 1

References for Example 1

[0144]1. Bardeesy N, DePinho R A. Pancreatic cancer biology and genetics. Nature Publishing Group 2002; 12:897-909.[0145]2. Koshiba T, Hosotani R, Wada M, Miyamoto Y, Fujimoto K, Lee J U, et al. Involvement of matrix metalloproteinase-2 activity in invasion and metastasis of pancreatic carcinoma. Cancer; 1998. p. 642-50.[0146]3. Strimpakos A, Saif M W, Syrigos K N. Pancreatic cancer: from molecular pathogenesis to targeted therapy. Cancer Metastasis Rev 2008; 3:495-522.[0147]4. Antwi K, Hostetter G, Demeure M J, Katchman B A, Decker G A, Ruiz Y, et al. Analysis of the plasma peptidome from pancreas cancer patients connects a peptide in plasma to overexpression of the parent protein in tumors. J Proteome Res 2009; 10:4722-31.[0148]5. Coppock D L, Cina-Poppe D, Gilleran S. The quiescin Q6 gene (QSCN6) is a fusion of two ancient gene families: thioredoxin and ERV 1. Genomics 1998; 3:460-8.[0149]6. Coppock D. Regulation of the Quiescence-Induced Genes: Quiescin Q...

example 2

[0177]We designed two short hairpin RNAs (shRNA1 and shRHA2) to knock-down QSOX1 protein expression in tumor cells.

[0178]shRNA1-Targeting QSOX1 sequence begins at the 970th base pair—ATCTACATGGCTGACCTGGAA (SEQ ID NO:17)

[0179]shRNA2-Targeting QSOX1 sequence begins at the 1207th base pair—AGGAAAGAGGGTGCCGTTCTT (SEQ ID NO:18)

[0180]QSOX1 shRNA1 hybridizes with nucleotides 970-989 of the QSOX1 transcript. QSOX1 shRNA2 hybridizes to nucleotides 1207-1226 of the transcript. Both shRNAs, independently and together suppressed the production of QSOX1 protein (data not shown) and cell proliferation. Upon cloning the QSOX1 shRNA into a eukaryotic expression vector (pCS2 mammalian overexpression vector with a CMV promoter) and using it to transfect a pancreatic tumor cell line (BxPC-3), a 30-40% decrease in cell viability was observed, over a 4 to 6 day period, compared to untreated and scrambled shRNA controls. (FIG. 6) Using the same transfection protocol in a separate experiment, we made an a...

example 3

[0183]MIAPaCa2 and Panc-1 pancreatic tumor cells were transduced with shRNA that specifically knocked down QSOX1 protein in the tumor cells. The shRNAs used to knockdown QSOX1 in tumor cells were QSOX1 sh742 (5′-CCGGGCCAATGTGGTGAGAAAGTTTCTCGAGAAACTTTCTCACCACATTGGCTTTTTG-3′ (SEQ ID NO:26)) and shRNA QSOX1 sh528 5′-CCGGACAATGAAGAAGCCTTT-3′ (sense) (SEQ ID NO:21), Nude mice Human pancreatic tumor cells (MIAPaCa2) were transduced with a lentivirus encoding shQSOX1 (sh528 and sh742) and shScramble (control). One million MIAPaCa2 cells were mixed with Matrigel™ and used to inoculate nude mice (5 mice / group) on day 0. After day 12, tumor growth was measured every 3 days (x-axis) and reported as “Tumor volume” on the Y-axis. “Untreated” indicates that tumor cells were not transduced. (see FIGS. 8 and 9). This in vivo experiment thus validates QSOX1 as a potential target for anti-neoplastic drugs. Any other type of inhibitor of QSOX1 expression or function would have a similar effect on tumo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Fractionaaaaaaaaaa
Nucleic acid sequenceaaaaaaaaaa
Login to View More

Abstract

The present invention provides methods for tumor treatment by administering an inhibitor of quiescin sulfhydryl oxidase 1 (QSOX1), compositions comprising such inhibitors, and methods for identifying such inhibitors.

Description

CROSS-REFERENCE[0001]This application is a continuation in part of U.S. patent application Ser. No. 13 / 847,930 filed Mar. 20, 2013, which claims priority to U.S. Provisional Patent Application Ser. No. 61 / 722,396 filed Nov. 5, 2012 and to PCT Application Serial No. PCT / US11 / 52122 filed Sep. 19, 2011, which claims priority to U.S. Provisional Patent Application Ser. No. 61 / 384,502 filed Sep. 20, 2010. Each application is incorporated by reference herein in its entirety.BACKGROUND[0002]Pancreatic ductal adenocarcinoma (PDA) is a disease that carries a poor prognosis. It is often detected in stage III resulting in an unresectable tumor at the time of diagnosis. However, even if pancreatic cancer is surgically resected in stage I or II, it may recur at a metastatic site (1, 2). Currently, patients diagnosed with pancreatic ductal adenocarcinoma have less than a 5% chance of surviving past five years (3).[0003]Breast adenocarcinoma is the most common cancer diagnosed in women throughout ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12Q1/26G01N33/50C07K16/40A61K38/44
CPCC12N15/1137A61K38/44G01N33/5008C12N15/1135C12Q1/26C07K16/40C12Y108/03002C12N2310/14C12N2310/531C12N2310/11C12Q1/6886C12Q2600/118C12Q2600/158G01N33/5011C12N2320/30A61K39/3955A61K39/39558A61K2121/00
InventorLAKE, DOUGLASKATCHMAN, BENJAMIN
OwnerARIZONA STATE UNIVERSITY