Marker ldh of cerebral polycephaly and a kit for diagnosing cerebral polycephalic

Abstract

The invention belongs to the field of diagnosis of animal diseases, and in particular relates to coenurus cerebralis marker LDH and a coenurus cerebralis diagnosis kit. The maximum P / N value of negative and positive serum of an indirect ELISA diagnostic method established on the basis of a LDH recombinant protein as an antigen is 1.956, the sensitivity is 1:3200, and the specificity is 71%. In addition, and clinical test results show that in serum of goats artificially infected with Taenia multiceps, antibodies can be detected in the serum of the goats third week after attacking larvae, so that the LDH recombinant protein can be used as a coenurus cerebralis marker for coenurus cerebralis diagnosis. An indirect ELISA diagnostic kit can be used for rapid, sensitive and specific diagnosis of coenurus cerebralis, and lays the foundation for the evaluation of early diagnosis and treatment effect of coenurus cerebralis infection.

Description

technical field

[0001] The invention belongs to the field of animal disease diagnosis, and in particular relates to a marker LDH for cerebral polycephalus and a kit for diagnosing cerebral polycephalus. Background technique

[0002] Coenurus cerebralis, the middle-stage larva of Taenia multiceps, often parasitizes the central nervous system such as the brain and spinal cord of ungulate herbivores such as sheep, goats, and cattle. It can also infect humans and cause severe Fatal cerebral polycephalus. The insect is distributed worldwide and is common in vast pastoral areas such as Northwest my country, North China, and Northeast China. In recent years, the infection rate of animals has been on the rise.

[0003] The clinical manifestations of polycephalus are diverse, and typical clinical symptoms do not appear within a period of time after animal infection, so it is difficult to diagnose in the early stage of infection. Various clinical manifestations lead to the complexit...

Examples

Embodiment 1

[0048] Example 1. Extraction of brain polycephalic total RNA and amplification of LDH gene

[0049] Total RNA was extracted according to the instructions of the Animal Tissue Total RNA Extraction Kit, and stored at -70°C for later use.

[0050] According to the instructions of the reverse transcription kit, the extracted total RNA of Taenia polycephala was reverse-transcribed to synthesize cDNA, and then stored at 8°C.

[0051] The sequence encoding lactate dehydrogenase of unigene8687 (GenBank: JR904615.1) was found with reference to the Taenia polycephala transcriptome data, and the following primers were designed using Primer premiere 5.0 software, and the primers were sent to Yingwei Jieji Company for synthesis.

[0052] Upstream primer P1 5'-ATGTCAGCTACAAAGGAACGAACATTTA-3'

[0053] Downstream primer P2 5'-CTATTCATACACCCAAGTAATTGTTGCTG-3'

[0054] PCR amplification system: Add the following components to the PCR reaction tube: 2×Taq PCR MasterMix: 12.5 μL; template cDNA ...

Embodiment 2

[0057] Embodiment 2, the construction of prokaryotic expression vector

[0058] 1. Design, amplification and cloning of LDH gene expression primers

[0059] According to the LDH gene sequence, Primer5.0 was used to design primers, and restriction endonuclease sites EcoRI and Xho I were added to the 5' ends of the upstream and downstream primers respectively. The primer sequences were as follows:

[0060] Upstream primer P1: 5'-CCG GAATTC ATGTCAGCTACAAAGGAACGAACAT TTA-3 (contains EcoRI restriction site, underlined sequence)

[0061] Downstream primer P2: 5'-CCC AAGCTT CTATTCATACACCCAAGTAATTGTTG CTG-3' (Xho I restriction site, underlined sequence)

[0062] See Example 1 for the PCR reaction system and amplification procedure. The PCR amplified product was electrophoresed in 1% agarose gel, stained with Gold-view, the band of interest was excised, purified and connected to pMD19-T vector. According to the instructions of the plasmid extraction kit, the plasmids of cloned s...

Embodiment 3

[0069] Example 3. Induced expression and SDS-P AGE analysis of recombinant plasmid pET32a(+)-Tm-LDH in Escherichia coli

[0070]Insert a single white colony BL21(DE3) of the pET32a(+)-Tm-LDH plasmid into 2mL LB culture solution (containing Amp100μg / mL), culture overnight on a shaker at 37°C; take 1mL culture solution and inoculate the other two 100mL bottles In the LB culture medium containing Amp (100μg / mL), cultivate it under a shaker at 37°C for 5h; add IPTG to one of the bottles to a final concentration of 1mmol / L, and the other bottle is a control culture (without IPTG); take 1mL bacteria respectively The solution was transferred into two new centrifuge tubes, centrifuged at 12,000r / min for 2min, and the supernatant was removed to collect the bacteria. Polyacrylamide gel electrophoresis (SDS-PAGE) detection, see the results Figure 4 .

[0071] Figure 4 The results showed that the pET32a(+)-Tm-LDH recombinant bacteria induced at 37°C for 5 hours after adding IPTG, sho...

technical field

[0001] The invention belongs to the field of animal disease diagnosis, and in particular relates to a marker LDH for cerebral polycephalus and a kit for diagnosing cerebral polycephalus. Background technique

[0002] Coenurus cerebralis, the middle-stage larva of Taenia multiceps, often parasitizes the central nervous system such as the brain and spinal cord of ungulate herbivores such as sheep, goats, and cattle. It can also infect humans and cause severe Fatal cerebral polycephalus. The insect is distributed worldwide and is common in vast pastoral areas such as Northwest my country, North China, and Northeast China. In recent years, the infection rate of animals has been on the rise.

[0003] The clinical manifestations of polycephalus are diverse, and typical clinical symptoms do not appear within a period of time after animal infection, so it is difficult to diagnose in the early stage of infection. Various clinical manifestations lead to the complexit...

Examples

Embodiment 1

[0048] Example 1. Extraction of brain polycephalic total RNA and amplification of LDH gene

[0049] Total RNA was extracted according to the instructions of the Animal Tissue Total RNA Extraction Kit, and stored at -70°C for later use.

[0050] According to the instructions of the reverse transcription kit, the extracted total RNA of Taenia polycephala was reverse-transcribed to synthesize cDNA, and then stored at 8°C.

[0051] The sequence encoding lactate dehydrogenase of unigene8687 (GenBank: JR904615.1) was found with reference to the Taenia polycephala transcriptome data, and the following primers were designed using Primer premiere 5.0 software, and the primers were sent to Yingwei Jieji Company for synthesis.

[0052] Upstream primer P1 5'-ATGTCAGCTACAAAGGAACGAACATTTA-3'

[0053] Downstream primer P2 5'-CTATTCATACACCCAAGTAATTGTTGCTG-3'

[0054] PCR amplification system: Add the following components to the PCR reaction tube: 2×Taq PCR MasterMix: 12.5 μL; template cDNA ...

Embodiment 2

[0057] Embodiment 2, the construction of prokaryotic expression vector

[0058] 1. Design, amplification and cloning of LDH gene expression primers

[0059] According to the LDH gene sequence, Primer5.0 was used to design primers, and restriction endonuclease sites EcoRI and Xho I were added to the 5' ends of the upstream and downstream primers respectively. The primer sequences were as follows:

[0060] Upstream primer P1: 5'-CCG GAATTC ATGTCAGCTACAAAGGAACGAACAT TTA-3 (contains EcoRI restriction site, underlined sequence)

[0061] Downstream primer P2: 5'-CCC AAGCTT CTATTCATACACCCAAGTAATTGTTG CTG-3' (Xho I restriction site, underlined sequence)

[0062] See Example 1 for the PCR reaction system and amplification procedure. The PCR amplified product was electrophoresed in 1% agarose gel, stained with Gold-view, the band of interest was excised, purified and connected to pMD19-T vector. According to the instructions of the plasmid extraction kit, the plasmids of cloned s...

Embodiment 3

[0069] Example 3. Induced expression and SDS-P AGE analysis of recombinant plasmid pET32a(+)-Tm-LDH in Escherichia coli

[0070]Insert a single white colony BL21(DE3) of the pET32a(+)-Tm-LDH plasmid into 2mL LB culture solution (containing Amp100μg / mL), culture overnight on a shaker at 37°C; take 1mL culture solution and inoculate the other two 100mL bottles In the LB culture medium containing Amp (100μg / mL), cultivate it under a shaker at 37°C for 5h; add IPTG to one of the bottles to a final concentration of 1mmol / L, and the other bottle is a control culture (without IPTG); take 1mL bacteria respectively The solution was transferred into two new centrifuge tubes, centrifuged at 12,000r / min for 2min, and the supernatant was removed to collect the bacteria. Polyacrylamide gel electrophoresis (SDS-PAGE) detection, see the results Figure 4 .

[0071] Figure 4 The results showed that the pET32a(+)-Tm-LDH recombinant bacteria induced at 37°C for 5 hours after adding IPTG, sho...

Images