Method for detecting n-terminal pre-BNP

A sample and antibody technology, applied in the direction of microorganism-based methods, chemical instruments and methods, biochemical equipment and methods, etc., can solve problems such as no detection, achieve good resolution, prolong survival probability, and easy survival probability effect

Inactive Publication Date: 2013-04-03
ROCHE DIAGNOSTICS GMBH
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0012] Therefore, there is no method in the art for the detection of N-terminal proBNP that enables reliable and sensitive detection of native N-terminal proBNP during short incubation periods

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting n-terminal pre-BNP
  • Method for detecting n-terminal pre-BNP
  • Method for detecting n-terminal pre-BNP

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Production method of recombinant N-terminal proBNP (1-76)

[0053] 1. Cloning of recombinant N-terminal proBNP

[0054] The nucleotide sequence of N-terminal proBNP (amino acid sequence 1-76) was produced by means of genetic synthesis. For optimal expression of the gene in E. coli, the sequence was adapted to the most commonly used codons in E. coli. The oligonucleotide sequence used to generate the gene is as follows:

[0055] Pro5' (SEQ ID NO1)

[0056] 5'CCGGATCCCACCCGCTG3'

[0057] Prolhum (SEQ ID NO2):

[0058] 5'CGGGATCCCACCCGCTGGGTTCCCCGGGTTCCGCTTCCGACCTGGAAACCT

[0059] CCGGTCTGCAGOAACAGCGTAACCACCT3'

[0060] Pro2hum (SEQ ID NO3).

[0061] 5'CGGTTCCAGGGAGGTCTGTTCAACCTGCAGTTCGGACAGTTTACCCTGCAG

[0062] GTCGTTACGCTGTTCCTGC3'

[0063] Pro3hum (SEQ ID NO4).

[0064] 5'CAGACCTCCCCTGGAACCGCTGCAGGAATCCCCGCGTCCGACCGOTGTTTGG

[0065] AAATCCCGTGAAGTTGCTAC3'

[0066] Pro4hum (SEQ ID NO5):

[0067] 5'CCCAAGCTTAACGCGGAGCACGCAGGGTGTACAGAACCATTTTACGGTGA

[0068] C...

Embodiment 2

[0075] Production of polyclonal antibodies against N-terminal proBNP

[0076] 1. Immunization

[0077] Sheep were immunized with recombinant N-terminal proBNP(1-76) in complete Freund's adjuvant. The dose is 0.1 mg per animal. Immunizations were repeated at 4-week intervals over a 10-month period. Starting 6 weeks after the first immunization, serum was taken monthly and its sensitivity and titer determined.

[0078] 2. Purification of Polyclonal Antibody from Sheep Serum

[0079] Starting from the crude serum of sheep immunized with N-terminal proBNP, the lipid components were removed by a delipidation process performed in aerosol. Immunoglobulins were then isolated with ammonium sulfate (2M). 15 mM KPO at pH 7.0 4 , 50 mM NaCl and the dissolved precipitate was dialyzed and subjected to DEAE sepharose chromatography. In the IgG fraction, PAKS-IgG(DE) was present in the eluted fraction.

[0080] 3. Sequential affinity chromatography for the generation of NT-proBN...

Embodiment 3

[0089] Production and detection of monoclonal antibody against N-terminal proBNP(1-76)

[0090] 1. Obtain monoclonal antibody against NT-proBNP(1-76)

[0091] 8-12 week old Balb / c mice were administered intraperitoneally with 100 μg of recombinant N-terminal proBNP antigen with Freund's adjuvant for immunization. After 6 weeks, 3 further immunizations were performed at 4 week intervals. Blood was drawn one week after the last immunization and the antibody titers in the sera of the test animals were determined. B-lymphocytes were obtained from the spleens of positive responding mice and fused with immortalized myeloma. The fusion is based on and the known method of Millstein (Nature 256, 1975, p.495-497). Primary cultures of hybrid cells constructed here are cloned by common means, for example, by use of commercially available cell sorters or by "limiting dilution". Only those clones, which react positively with recombinant N-terminal proBNP and recognize native N-termi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
sensitivityaaaaaaaaaa
Login to View More

Abstract

A new method to detect N-terminal pro-brain natriuretic peptide (BNP) in a sample is characterized in that at least two antibodies, that recognize different epitopes of the N-terminal pro-BNP, are used. Independent claims are also included for the following: (1) recombinant N-terminal pro-BNP; (2) an antibody against recombinant N-terminal pro-BNP; (3) cell lines M10.1.11 or M13.4.14 deposited on the 26.01.1999 at the DSMZ (undefined); and (4) methods to produce polyclonal or monoclonal antibodies of (2).

Description

[0001] This application is a divisional application of Chinese patent application No. 00803234.3 submitted on July 27, 2001. technical field [0002] The present invention relates to a method for identifying N-terminal proBNP (N-terminalem proBNP) in a sample by means of at least two antibodies that detect different epitopes of N-terminal proBNP. This method was used to differentiate or classify samples from healthy individuals and NYHA class I to IV patients. The present invention further relates to recombinant N-terminal proBNP, the use of said N-terminal proBNP as a standard in a method for identifying N-terminal proBNP, for detecting antibodies to recombinant N-terminal proBNP and their production. Background technique [0003] Heart failure is a widespread phenomenon, especially in the Western world. According to Roche's Medical Dictionary (1993, Urban & Schwarzenberg), heart failure is the acute or chronic decline in the ability of the heart to generate metabolically ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): G01N33/68G01N33/53C07K16/26C07K14/575C12N5/10C12N15/02C12N15/09C12P21/08C12R1/91G01N
CPCC07K2317/34C07K16/26G01N33/6887G01N33/68
InventorJ·卡尔H·利尔P·斯塔尔K·克吕格尔A·博格亚A·加卢塞尔
OwnerROCHE DIAGNOSTICS GMBH