Method for acquiring molecular marker correlative with peony type character and special primer used thereof

A molecular marker, peony flower technology, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc. The effect of improving accuracy and efficiency, shortening the breeding cycle

Inactive Publication Date: 2011-06-22
INST OF BOTANY CHINESE ACAD OF SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The traditional cross-breeding method has a long cycle and cannot screen the target traits early, which seriously limits the speed of breeding new varieties

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for acquiring molecular marker correlative with peony type character and special primer used thereof
  • Method for acquiring molecular marker correlative with peony type character and special primer used thereof
  • Method for acquiring molecular marker correlative with peony type character and special primer used thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1. Acquisition of SSR markers related to peony flower type traits

[0032] 1. Design of candidate primers

[0033] The inventor's laboratory has developed following primers according to the DNA sequence of the B class MAD-box gene of tree peony:

[0034] Forward primer 1 (sequence 1 of the sequence listing): CAAGAAGGTCAACAATAAAC;

[0035] Forward primer 2 (sequence 2 of the sequence listing): CAAGGAGGTCAACAATAAAC;

[0036] Reverse primer 1 (sequence 3 of the sequence listing): CACAGAAGCCTCCATATTTT;

[0037] Reverse primer 2 (SEQ ID NO: 4 of the Sequence Listing): CACAGAAGCCTCCATTTTTT.

[0038] There are four combinations of the above four primers, so the four sets of primer pairs are defined as follows: primer pair A: forward primer 1 and reverse primer 1; primer pair B: forward primer 2 and reverse primer 1; primer pair C: forward Primer 1 and reverse primer 2; primer pair D: forward primer 2 and reverse primer 2.

[0039] 2. Screening of primer pairs

[00...

Embodiment 2

[0071] Embodiment 2, the optimization of parameter

[0072] Using 'Guanshi Moyu' as the test material, the parameters were optimized.

[0073] 1. Optimization of PCR conditions

[0074] 1. Optimization of annealing temperature

[0075] The young leaves were harvested during the vigorous growth period of the plants, rinsed with tap water, dried and used for extraction of total DNA. The total DNA in the young leaves of peony was extracted according to the method in Xiaoyan Han et al. (Biochem. Genet. 2008, 46: 162-179).

[0076] Using the total DNA as a template, PCR was performed on A with primers. Four annealing temperatures (52.1°C, 53.5°C, 55.4°C, 57.4°C) were selected to optimize the annealing temperature.

[0077] PCR reaction system (20 μL): 3 μL DNA template (10-50ng), 1 μL forward primer (10uM), 1 μL reverse primer (10uM), 10 μL 2×Easy Taq PCR SuperMix (without dye) (purchased from Beijing Quanshijin Biotechnology Co., Ltd.), 5.0 μL ddH 2 O.

[0078] The reaction...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for acquiring molecular markers associated with peony-type properties and special primers thereof. The special primers for acquiring molecular markers associated with peony-type properties provided by the invention comprise the following primer pair: DNA sequences represented by the sequences 1 and 2 in the sequence table. The method provided by the invention adopts the special primers to perform PCR amplification on the peony genomes to be detected and modified polyacrylamide gel electrophoresis on the PCR amplified products, and determine the molecular markers associated with properties of the peony to be detected according to the type of electrophoretic band. The molecular marker provided by the invention is capable of detecting the peony-type properties, improving the accuracy and efficiency of the peony selective breeding and reducing the breeding period, thus providing an effective method for the breeding of peonies upon types.

Description

technical field [0001] The invention relates to a method for obtaining molecular markers related to peony flower shape traits and special primers thereof. Background technique [0002] Peony belongs to the woody group of the genus Paeoniae. It is a unique traditional flower in China and is known as the "King of Flowers". The traditional cross-breeding method has a long cycle and cannot screen the target traits early, which severely limits the speed of breeding new varieties. Molecular marker technology can link markers with plant traits, providing a new means for peony breeding. The use of DNA marker-assisted selection breeding will bring revolutionary changes to traditional cross-breeding. The traditional breeding selection is to select the variation of phenotypic traits, but some important traits (such as flower color, flower type and other traits closely related to ornamental quality) cannot be detected in the early stage. Molecular marker technology can use seeds and s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/68C12N15/11C12P19/34
Inventor舒庆艳张晶晶王亮生
OwnerINST OF BOTANY CHINESE ACAD OF SCI