Method for acquiring molecular marker correlative with peony type character and special primer used thereof
A molecular marker, peony flower technology, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc. The effect of improving accuracy and efficiency, shortening the breeding cycle
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1. Acquisition of SSR markers related to peony flower type traits
[0032] 1. Design of candidate primers
[0033] The inventor's laboratory has developed following primers according to the DNA sequence of the B class MAD-box gene of tree peony:
[0034] Forward primer 1 (sequence 1 of the sequence listing): CAAGAAGGTCAACAATAAAC;
[0035] Forward primer 2 (sequence 2 of the sequence listing): CAAGGAGGTCAACAATAAAC;
[0036] Reverse primer 1 (sequence 3 of the sequence listing): CACAGAAGCCTCCATATTTT;
[0037] Reverse primer 2 (SEQ ID NO: 4 of the Sequence Listing): CACAGAAGCCTCCATTTTTT.
[0038] There are four combinations of the above four primers, so the four sets of primer pairs are defined as follows: primer pair A: forward primer 1 and reverse primer 1; primer pair B: forward primer 2 and reverse primer 1; primer pair C: forward Primer 1 and reverse primer 2; primer pair D: forward primer 2 and reverse primer 2.
[0039] 2. Screening of primer pairs
[00...
Embodiment 2
[0071] Embodiment 2, the optimization of parameter
[0072] Using 'Guanshi Moyu' as the test material, the parameters were optimized.
[0073] 1. Optimization of PCR conditions
[0074] 1. Optimization of annealing temperature
[0075] The young leaves were harvested during the vigorous growth period of the plants, rinsed with tap water, dried and used for extraction of total DNA. The total DNA in the young leaves of peony was extracted according to the method in Xiaoyan Han et al. (Biochem. Genet. 2008, 46: 162-179).
[0076] Using the total DNA as a template, PCR was performed on A with primers. Four annealing temperatures (52.1°C, 53.5°C, 55.4°C, 57.4°C) were selected to optimize the annealing temperature.
[0077] PCR reaction system (20 μL): 3 μL DNA template (10-50ng), 1 μL forward primer (10uM), 1 μL reverse primer (10uM), 10 μL 2×Easy Taq PCR SuperMix (without dye) (purchased from Beijing Quanshijin Biotechnology Co., Ltd.), 5.0 μL ddH 2 O.
[0078] The reaction...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 