Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Transgenosis construct and application thereof in preparing space-time adjustable liver damage model

A technology for liver damage and constructs, which is applied to cells modified by the introduction of foreign genetic material, introduction of foreign genetic material using vectors, animal husbandry, etc.

Inactive Publication Date: 2012-05-02
SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the core of hepatocyte transplantation research is still the source of hepatocytes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Transgenosis construct and application thereof in preparing space-time adjustable liver damage model
  • Transgenosis construct and application thereof in preparing space-time adjustable liver damage model
  • Transgenosis construct and application thereof in preparing space-time adjustable liver damage model

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0070] Animal model preparation

[0071] After obtaining the transgenic construct, conventional methods can be used to transfer the linearized construct into a fertilized egg. After the birth of the offspring animal, various methods known in the art (including but not limited to PCR detection, Southern blotting, etc.) can be used to identify whether the transgenic construct is integrated into its genome, thereby obtaining a transgenic animal.

[0072] Therefore, the present invention also provides a method for preparing a spatiotemporal adjustable liver injury model, the method comprising: (1) introducing the construct 1 of claim 1 into a fertilized egg of a non-human mammal, and transferring it into The fertilized egg with the construct is transferred into the fallopian tube of the pseudo-pregnant non-human mammal to continue its development to generate a non-human mammal integrated with the construct 1 of claim 1 in the genome; (2) claim 1 The construct 2 is introduced into a fe...

Embodiment 1

[0099] Example 1. Determine the most suitable gene for inducing hepatocyte apoptosis

[0100] It is known that there are many genes that can induce cell apoptosis. In this example, the most suitable gene for inducing hepatocyte apoptosis is first selected.

[0101] Using the conventional FACS method, the three genes Caspase8, Bax, tBid were compared to induce hepatocyte apoptosis to determine the most suitable gene. Caspase8, Bax, and tBid were cloned into the vector pcDNA3.1 (purchased from Invitrogen). Using mouse liver cDNA as a template, the primer sequences are (upstream primer sets Eco RI site, downstream primer sets XhoI site):

[0102] Caspase8F (SEQ ID NO: 2):

[0103] CTCT GAATTC CCATGGATTTCCAGAGTTGTCTTTATGC;

[0104] Caspase8R (SEQ ID NO: 3):

[0105] GCAC CTCGAG TTAGGGAGGGAAGAAGAGCTTCTT;

[0106] Bax F (SEQ ID NO: 4):

[0107] GCA GGAATTC CCATGGACGGGTCCGGGGAG;

[0108] Bax R (SEQ ID NO: 5):

[0109] GTGG CTCGAG TCAGCCCATCTTCTTCCAGATGG;

[0110] tBid F (SEQ ID NO: 6):

[0111]...

Embodiment 2

[0116] Example 2. Construction of Transgenic Vector

[0117] PCR was used to amplify the tBid and Bax genes from mouse liver cDNA and ligate them into the pMD18T-simple vector.

[0118] The primer sequence is as follows:

[0119] tBid F (SEQ ID NO: 8):

[0120] 5’-ATATAGATCTACCATGGGCAGCCAGGCCA-3’;

[0121] tBid R (SEQ ID NO: 7):

[0122] 5’-GCGCCTCGAGTCAGTCCATCTCGTTTCTAACCAAG-3’;

[0123] Bax F (SEQ ID NO: 9):

[0124] 5’-ATATAGATCTACCATGGACGGGTCCGGG-3’;

[0125] Bax R (SEQ ID NO: 5):

[0126] 5'-GTGGCTCGAGTCAGCCCATCTTCTTCCAGATGG-3'.

[0127] The PCR amplification conditions are as follows:

[0128] tBid: first 94°C, 5min; then 94°C, 30s; 56°C, 30s; 72°C, 30s; 30 cycles; finally 72°C, 10min.

[0129] Bax: first 94°C, 5min; then 94°C, 30s; 58°C, 30s; 72°C, 30s; 30 cycles; finally 72°C, 10min.

[0130] The IRES sequence was cut from pIRES2-EGFP with BglII and NcoI and ligated to the corresponding site in pET28a to obtain pET28a-IRES; then by PCR, Bax and tBid were amplified from liver cDNA and ins...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a transgenosis construct and an application thereof in preparing a space-time adjustable liver damage model and discloses a construct combination used for preparing the space-time adjustable liver damage model. The construct combination comprises a construct expressing space-time adjustable liver damage induction induced gene and a construct expressing Cre recombinant enzyme. The invention also discloses cells containing the construct and a method for preparing the space-time adjustable liver damage model. The obtained animal model can efficiently induce the liver damage at any time, and provides an effective way for the research of hepatic cell transplantation and liver replantation.

Description

Technical field [0001] The invention belongs to the field of biotechnology, and specifically relates to a transgenic construct and its application in preparing a spatiotemporal adjustable liver injury model. Background technique [0002] Liver organ transplantation is currently the main method for clinical treatment of acute liver failure, end-stage liver disease and metabolic liver disease. However, due to the shortage of donor livers, the clinical application of liver organ transplantation has been severely restricted. Approximately 14,000 people in the United States wait for liver transplantation each year, of which 50% wait for more than one year, and about 1,300 people die each year because they cannot wait for liver transplantation. The waiting list for organ transplantation in our country is also increasing. Therefore, other clinical methods are urgently needed to improve liver function, extend the survival time of patients to wait for liver transplantation, or replace l...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/85C12N5/10A01K67/027
Inventor 王欣胡晓
Owner SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com