Method for amplifying and sequencing S whole gene of porcine epidemic diarrhea virus and application of method
A porcine epidemic diarrhea and whole gene technology is applied in the field of porcine epidemic diarrhea virus S whole gene amplification and sequencing, which can solve the problem of not obtaining the S gene and the like, and achieve the effect of low cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Embodiment 1: extract porcine epidemic diarrhea virus RNA
[0036] Take the disease sample of the sick pig, name it GD-YJ1, centrifuge at 1200rpm, and freeze and thaw repeatedly at -20°C for 2-3 times to obtain the supernatant of the sample, and then use OMEGA's E.Z.N.A.ViralRNAKit kit to extract PEDVRNA. The specific operation steps as follows:
[0037] 1) Add 560 μL of QVL lysate, 5.6 μL of CarrierRNA and 10 μl of 1-mercaptoethanol to a 1.5 mL EP tube;
[0038] 2) Add 140 μL of sample supernatant;
[0039] 3) Incubate at room temperature for 5-10 minutes;
[0040] 4) Add 560 μL of absolute ethanol, mix or use a vortex shaker to mix for 30 seconds;
[0041] 5) Add the mixed solution in step 4) to the HiBindRNA adsorption column (equipped with a 2mL collection tube), centrifuge, and discard the liquid in the collection tube;
[0042] 6) Repeat step 5) until all the mixed solution is collected through the RNA adsorption column;
[0043] 7) Assemble the RNA adsorpt...
Embodiment 2
[0050] Example 2: Primer Design
[0051] Primers were designed from the S gene of USA-Colorado-2013 with GeneBank accession number KF272920.1 as a template.
[0052] The full length of the S gene ranges from 20634 to 24794, among which the S1 gene: 20634bp-23000bp; the S2 gene: 23001bp-24794bp. Due to the low accuracy of the electrophoresis peaks at both ends of the sequencing results at 20-30bp, two pairs of primers SCX1, SCX2, the starting point and the ending point are both outside the target gene, and can cover the entire S gene after splicing,
[0053] The specific primers for SCX1 are as follows:
[0054] SEQIDNo.1 SCX1 upstream primer: CCAATTATATCTTCTGGCGTAATTC
[0055] SEQIDNo.2SCX1 downstream primer: TAATACTCATACTAAAGTTGGTGGG
[0056] The specific primers for SCX2 are as follows:
[0057] SEQIDNo.3 SCX2 upstream primer: ACCATTCTAATGATGGCTCTAATTG
[0058] SEQIDNo.4SCX2 downstream primer: ATAAAAACACTGGTGAAAAGAAAAC
[0059] The RT-PCR amplification range map of S...
Embodiment 3
[0060] Embodiment 3: RT-PCR amplification
[0061] 1) RT-PCR amplification of SCX1 gene fragment
[0062] Use SCX1 upstream primer and downstream primer to perform one-step RT-PCR amplification on RNA to obtain SCX1 gene PCR product. The RT-PCR reaction system is as follows: 2 μL PrimeScript 1 step Enzyme Mix, 25 μL 2×1 stepbuffer, 1 μL SCX1 upstream primer (20uM / μL); 1 μL SCX1 downstream Primer (20uM / μL); 1 μL of the RNA obtained in Example 1; ddH 2 O supplemented to 50 μL;
[0063] The reaction program of the RT-PCR amplification: 50° C. for 30 min, 94° C. for 2 min; 94° C. for 30 s, 55° C. for 30 s, 72° C. for 2 min and 30 s, set 30 cycles.
[0064] 2) Use SCX2 upstream primers and downstream primers to perform one-step RT-PCR amplification of viral RNA to obtain SCX2 gene PCR products. The RT-PCR reaction system is as follows: 2μL PrimeScript1stepEnzymeMix, 25μL 2×1stepbuffer, 1μL SCX2 upstream primer (20uM / μL) 1 μ L SCX2 downstream primer (20uM / μL); 1 μ L of the RNA ob...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Density | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More