Method for constructing PD1 humanized BALB/c mouse model and application thereof
A humanized and mouse technology, which is applied in the field of animal genetic engineering and genetic modification, can solve the problems of being easily suppressed, low PD1 response, and inhomogeneity, so as to enhance accuracy, ensure success rate, and expand extensiveness Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] Example 1: Establishment of BALB / c-PD1 humanized mouse model
[0051] 1. Determine the replacement region of the human fragment and the inserted human sequence
[0052] According to the binding domain of human PD1 and PDL1 protein, we selected Exon2 and 3 of human PD1 sequence to replace Exon2 and 3 of mouse PD1 (No. 11633 to 123333 of PD1 gene), and retained the transmembrane region and intracellular region of mouse PD1 , the selected human PD1 gene sequence is shown in SEQ No.1.
[0053] PD1人源化序列tccccagacaggccctggaacccccccaccttctccccagccctgctcgtggtgaccgaaggggacaacgccaccttcacctgcagcttctccaacacatcggagagcttcgtgctaaactggtaccgcatgagccccagcaaccagacggacaagctggccgccttccccgaggaccgcagccagcccggccaggactgccgcttccgtgtcacacaactgcccaacgggcgtgacttccacatgagcgtggtcagggcccggcgcaatgacagcggcacctacctctgtggggccatctccctggcccccaaggcgcagatcaaagagagcctgcgggcagagctcagggtgacaggtgcggcctcggaggccccggggcaggggtgagctgagccggtcctggggtgggtgtcccctcctgcacaggatcaggagctccagggtcgtagggcagggaccccccagctccagtccaggg...
Embodiment 2
[0109] Example 2 PD1 expression and functional verification of PD1 humanized mice
[0110] In this example, the transcription of human PD1 in heterozygotes is detected by mRNA, and then the expression of humanized genes in heterozygotes and homozygotes is analyzed by flow cytometry, and the immune cell populations are checked. After analysis, the humanized gene can be successfully expressed Genes, and mice that do not cause obvious abnormalities in the immune system can be used for tumor drug efficacy experiments.
[0111] 1. mRNA determination
[0112] The samples used in the experiment were humanized Pdcd153#♂(KI / wt) and BALB / c wild-type 54#♂(wt / wt). Extract 53#, 54# mouse spleen and thymus RNA for RT-PCR, and sequence the PCR products to verify whether the splicing of Pdcd1mRNA is correct. The sequencing results showed that the correct humanized mRNA was detected in the PCR product of 53#. The above results indicated that the chimeric mRNA splicing in humanized Pdcd1 mic...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Average volume | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



