Unlock instant, AI-driven research and patent intelligence for your innovation.

A method for Arabidopsis thaliana pepr2 protein and atpep1 small peptide to synergistically inhibit geminivirus infection

A geminivirus, synergistic technology, applied in botanical equipment and methods, chemicals for biological control, applications, etc., can solve problems such as unknown side effects, off-target, plant growth and development effects, etc.

Active Publication Date: 2021-05-18
SOUTH CHINA NORMAL UNIVERSITY
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] The main problem of this technology is: the overexpression of LSB1 / GDU3 gene itself constitutively and continuously activates the disease resistance pathway of plants, and the continuous accumulation of disease resistance signals leads to the influence of plant growth and development under normal conditions; at the same time, the resistance of this method The mechanism of action of the virus is unknown, and it may cause other unknown side effects during application
[0011] In addition, there are few effective prevention and treatment technologies for geminiviruses, which mainly use overexpression or knockdown of plant genes to activate related signaling pathways to improve resistance to viruses, and gene editing for viral DNA to disrupt the infection process; among them Overexpression and knockdown of plant genes mainly activate broad disease resistance pathways such as salicylic acid constitutively, or control virus replication by affecting plant cell cycle. Therefore, while improving disease resistance, the growth and development of the plant itself It may also have an impact; although the gene editing technology for viral DNA specifically destroys the structural integrity of the virus itself, existing studies have shown that the current technology may have off-target phenomena, which may have an impact on the genome of the plant itself

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for Arabidopsis thaliana pepr2 protein and atpep1 small peptide to synergistically inhibit geminivirus infection
  • A method for Arabidopsis thaliana pepr2 protein and atpep1 small peptide to synergistically inhibit geminivirus infection
  • A method for Arabidopsis thaliana pepr2 protein and atpep1 small peptide to synergistically inhibit geminivirus infection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] according to Figure 1-2 A method in which Arabidopsis PEPR2 protein and AtPep1 small peptide act synergistically to inhibit Geminivirus infection includes the following steps:

[0029] Step 1, selecting plants suffering from geminiviruses;

[0030] Step 2: Excessively express PEPR2 in the plant, and at the same time, apply AtPep1 small peptide exogenously to synergistically activate the antiviral mechanism.

[0031]所述PEPR2基因来源于拟南芥,所述PEPR2基因在编码区3267bp处的基因序列具体为TTTCAGTCTTGAGCTCTAATCTCAAATGAGGAATCTTGGGTTACTCGAAATTACTCTGCTTTGCTCTCTCTTTGTCTATTTCCGTATAGATTCTGTCTCTAGTTTAAACTCAGATGGTTTGGCTTTACTCTCGCTTCTCAAGCACTTTGATAAAGTCCCACTTGAAGTAGCTTCGACGTGGAAGGAGAACACATCTGAAACCACTCCATGTAATAATAACTGGTTTGGTGTCATTTGTGATCTTTCTGGTAATGTCGTCGAGACCCTTAATTTGTCTGCTTCTGGGCTTTCAGGCCAATTAGGTTCTGAAATTGGGGAGCTTAAGAGCTTGGTCACATTGGATCTCAGTCTTAACAGTTTCTCTGGTTTATTGCCTTCCACTTTAGGAAACTGTACTTCACTTGAGTATTTGGATTTGTCTAACAATGATTTTTCTGGAGAAGTTCCTGATATTTTTGGTAGCTTGCAGAATTTGACGTTTCTGTATCTTGATCGCAATAATCTTAGTGGTCTCATTCCT...

Embodiment 2

[0039] The application of PEPR2 and AtPep1 synergy in antiviral infection

[0040] 1) PEPR2 and AtPep1 synergistically affect the localization of BSCTV-encoded C4 protein in plant cells

[0041] In the early stage, through yeast two-hybrid screening, it was found that the PEPR2 protein encoded by Arabidopsis thaliana can interact with the C4 protein of BSCTV (currently unpublished), so the effect of PEPR2 and its corresponding small peptide AtPep1 on the localization of C4 protein in plant cells was analyzed , the specific operation steps are as follows:

[0042] S101, using Arabidopsis thaliana cDNA as a template, by the method of PCR (the primer information used is as follows: PEPR2-F primer: 5'-ACTACTAGTTTTTCAGTCTCTTGAGCTCTAATCT-3', because there is a high-level structure at the 5' end of the PEPR2 coding region, the primer is designed in The 5' non-coding region adjacent to the start codon; PEPR2-R primer: 5'-AGTGTCGACAGTGAACTGAACCCGAAGTGCTTC-3'), amplifies the PEPR2 gene...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for inhibiting Geminivirus infection through the synergistic effect of Arabidopsis PEPR2 protein and AtPep1 small peptide, and specifically relates to the field of methods for inhibiting Geminivirus infection. Plants; step 2, overexpressing PEPR2 in the plants, and at the same time, exogenously applying AtPep1 small peptides to synergistically activate the anti-virus mechanism. The present invention utilizes the synergistic method of plant-derived genes and small peptides to improve the resistance of plants to geminiviruses, and solves the problem that geminiviruses cause serious harm to crop production in my country. The regulation of the encoded C4 protein has developed a specific and controllable plant disease resistance method. Since C4 is a pathogenic factor with a conserved sequence in a variety of geminiviruses, this technology can be applied to other geminivirus species to improve future Virus resistance of crops.

Description

technical field [0001] The invention relates to the technical field of methods for inhibiting geminivirus infection, and more specifically, the invention relates to a method for inhibiting geminivirus infection through the synergistic effect of Arabidopsis thaliana PEPR2 protein and AtPep1 small peptide. Background technique [0002] Geminiviruses are a class of plant DNA viruses with a wide range of hosts, and many important crops are threatened by them. Geminiviruses have been found in food and economic crops in many provinces of my country, causing harm to agricultural production. Therefore, an in-depth study of the interaction between geminiviruses and plants is of great significance for preventing and controlling diseases, improving crop yields, and ensuring the development of agricultural production. [0003] Geminiviruses have a single-stranded DNA genome that encodes only a few proteins, and complete their life cycle by infecting and interacting with host cells. Af...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/82A01N47/44A01P1/00A01H5/00A01H6/82
Inventor 赖建彬阳成伟曾润秀刘晓诗
Owner SOUTH CHINA NORMAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More