Potential protein capable of serving as Alzheimer's disease drug action target and application thereof

A technology for Alzheimer's disease and drugs, applied in the field of biomedicine, can solve unclear problems and achieve the effect of weakened neural differentiation, significantly slowed down, and significantly reduced connections

Pending Publication Date: 2021-07-23
CHINA PHARM UNIV
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, in the research field of AD, whether PTBP1 can be used as the target of AD drugs is not clear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Potential protein capable of serving as Alzheimer's disease drug action target and application thereof
  • Potential protein capable of serving as Alzheimer's disease drug action target and application thereof
  • Potential protein capable of serving as Alzheimer's disease drug action target and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Example 1 Construction of AD cell model

[0060] (1) Construction of CRISPR / CAS9 gene editing method

[0061] The following processes are all operated under sterile conditions in the aseptic operating table:

[0062] ① Construct the RNP complex targeting ADAM10 gene: take 0.33μl crRNA respectively ADAM10 1 (UUUUUUUUUUAUAGGUCAGUA (SEQ ID ON.1), 100 μM), 0.33 μl of crRNA ADAM10 2 (UUUUUUUUAUAUAGGUCAGUAU (SEQ ID ON.2), 100 μM), 0.33 μl of crRNA ADAM10 3 (AAAUAUAUCAGACAUUAUGA (SEQ ID ON.3), 100 μM) was thoroughly mixed with 1 μl Alt-R.CRISPR-Cas9tracrRNA (100 μM), and then diluted to a concentration of 20-80 μM with a nuclease-free buffer to obtain an RNA mixture. The RNA mixture was heated at 95°C for 5 min and cooled at room temperature for 10 min to obtain an annealed RNA mixture. Take 2.9 μl of the annealed RNA mixture and 1 μl of Cas 9 protein according to the ratio of 1.2:1-2:1, mix thoroughly and leave at room temperature for 10 minutes. After adding 0.6 μl elec...

Embodiment 2

[0094] 2.1 Determination of ADAM10 target protein and inflammatory body NLRP3 in AD cell model

[0095] The protein level of ADAM10 in the knockout group was verified by Western staining. Such as figure 2 As shown in A, compared with the blank control KO group, the expression of ADAM10 protein in the ADAM10 KO group was extremely significantly decreased, which was consistent with the results of Sanger sequencing. The data further indicated that the ADAM10 gene was successfully knocked out in SH-SY5Y cells using CRISPR / Cas 9 gene editing technology. Subsequent experimental research can be carried out.

[0096] The inflammasome NLRP3 in the knockout group was verified at the protein level by Western staining. Such as image 3 As shown, compared with the Control KO group, ADAM10 KO group significantly increased NLRP3 and activated the expression of inflammasome.

[0097] 2.2 Determination of Aβ and Tau protein in AD cell model

[0098] The accumulation of Aβ and intracellu...

Embodiment 3

[0111] Example 3 Constructing the knockout cell line of PTBP1

[0112] The following processes are all operated under sterile conditions in the aseptic operating table:

[0113] ①Construction of RNP complexes: Take 0.33 μl of crRNA1 (GGCACCCCCUUUUCAGCAAA (SEQ ID ON.4), 100 μM), 0.33 μl of crRNA2 (AAUGACAGCAAGAAGUUCAA (SEQ ID ON.5), 100 μM), and 0.33 μl of crRNA3 (AAAGGUGACAGCCGAAGUGC (SEQ ID ON.5), respectively. ON.6), 100 μM) and 1 μl of Alt-R.CRISPR-Cas9 tracrRNA (100 μM) were thoroughly mixed and then diluted with a nuclease-free buffer to a concentration of 20-80 μM to obtain an RNA mixture. The RNA mixture was heated at 95°C for 5 min and cooled at room temperature for 10 min to obtain an annealed RNA mixture. Take 2.9 μl of the annealed RNA mixture and 1 μl of Cas 9 protein according to the ratio of 1.2:1-2:1, mix thoroughly and leave at room temperature for 10 minutes. After adding 0.6 μl electroporation enhancement solution, react at room temperature for 5 minutes to...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a potential protein capable of serving as an action target of an Alzheimer's disease drug and application of the potential protein. The invention discloses application of a substance for inhibiting PTBP1 gene expression in preparation of a medicine for treating Alzheimer's disease. According to the invention, ADAM10 is successfully knocked out from SH-SY5Y cells to construct an AD cell model, in the model, it is found for the first time that PTBP1 protein is significantly increased in ADAM10KO cells, and the interaction between PTBP1 and Tau is significantly enhanced. After the PTBP1 gene of the ADAM10KO cell is knocked out and the PTBP1 protein is knocked down, Abeta42 and Tau protein can be remarkably reduced, the cell neuronal differentiation capacity is enhanced, the neuronal length is remarkably increased, and meanwhile information exchange between cells is remarkably increased. The data shows that the PTBP1 protein can be a novel target spot in AD.

Description

technical field [0001] The invention belongs to the field of biomedicine, and relates to a potential drug target protein for Alzheimer's disease and its application. Background technique [0002] Some scientists believe that the accumulation of Aβ triggers and drives the accumulation of Tau protein, leading to neuronal death. Most drugs currently in clinical trials have multiple targets and cannot mainly target Tau protein, and a large number of studies have shown that their callback effect on Tau is not significant [1 -5]. Tau protein is normally found in our brain cells, it maintains the structure and stability of neurons, and it helps the transfer of nutrients in cells. When misfolded, Tau becomes viscous and less soluble, aggregates within neurons and forms neurofibrillary tangles, disrupts neuronal function and eventually leads to neuronal death, and only a small amount of misfolded Tau is needed protein that turns its neighboring brain cells into dysfunctional cells...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C12N15/113C12N9/22A61K45/00A61K48/00A61K38/46A61P25/28
CPCC07K14/4711C12N15/113C12N9/22A61K45/00A61K48/0008A61K38/465A61P25/28C12N2310/20
Inventor王广基李昔诺阿基业朱哲英徐进宜孙渊
OwnerCHINA PHARM UNIV