Unlock instant, AI-driven research and patent intelligence for your innovation.

Target protein for promoting neuron regeneration and application of target protein

A neuron and protein technology, applied in the field of biomedicine, can solve the problems that the research on the regeneration function of AD neurons has not been clarified, and it is impossible to predict the promotion effect of LRP1 neuron regeneration, so as to slow down the cell growth rate and significantly reduce the connection , the effect of significantly slowing down

Pending Publication Date: 2021-08-20
CHINA PHARM UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] Studies have shown that LRP1 protein can regulate the uptake and diffusion of Tau protein. Tau protein is one of the most popular hypotheses in Alzheimer's disease research, but it cannot predict whether LRP1 can promote the regeneration of neurons, and The function of LRP1 gene on neuronal regeneration in AD has not yet been elucidated

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Target protein for promoting neuron regeneration and application of target protein
  • Target protein for promoting neuron regeneration and application of target protein
  • Target protein for promoting neuron regeneration and application of target protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1 Construction of AD cell model

[0048] (1) Construction of CRISPR / CAS9 gene editing method

[0049] The following processes are all operated under sterile conditions in the aseptic operating table:

[0050] ① Construct the RNP complex targeting ADAM10 gene: take 0.33μl crRNA respectively ADAM10 1 (UUUUUUUUUUAUAGGUCAGUA (SEQ ID ON.1), 100 μM), 0.33 μl of crRNA ADAM10 2 (UUUUUUUUAUAUAGGUCAGUAU (SEQ ID ON.2), 100 μM), 0.33 μl of crRNA ADAM10 3 (AAAUAUAUCAGACAUUAUGA (SEQ ID ON.3), 100 μM) was thoroughly mixed with 1 μl Alt-R.CRISPR-Cas9 tracrRNA (100 μM), and then diluted to a concentration of 60 μM with a nuclease-free buffer to obtain an RNA mixture. The RNA mixture was heated at 95°C for 5 min and cooled at room temperature for 10 min to obtain an annealed RNA mixture. Take 2.9 μl of the annealed RNA mixture and 1 μl of Cas 9 protein according to the ratio of 1.2:1 and mix well, then leave it at room temperature for 10 minutes. After adding 0.6 μl electrop...

Embodiment 2

[0082] 2.1 Determination of ADAM10 target protein and inflammatory body NLRP3 in AD cell model

[0083] The protein level of ADAM10 in the knockout group was verified by Western staining. Such as figure 2 As shown in A, compared with the blank control KO group, the expression of ADAM10 protein in the ADAM10 KO group was extremely significantly decreased, which was consistent with the results of Sanger sequencing. The data further indicated that the ADAM10 gene was successfully knocked out in SH-SY5Y cells using CRISPR / Cas 9 gene editing technology. Subsequent experimental research can be carried out.

[0084] The inflammasome NLRP3 in the knockout group was verified at the protein level by Western staining. Such as image 3 As shown, compared with the Control KO group, ADAM10 KO group significantly increased NLRP3 and activated the expression of inflammasome.

[0085] 2.2 Determination of Aβ and Tau protein in AD cell model

[0086] The accumulation of Aβ and intracellu...

Embodiment 3

[0099] Example 3 Constructing a knockout cell line of LRP1

[0100] The following processes are all operated under sterile conditions in the aseptic operating table:

[0101] ①Construction of RNP complex: Take 0.33 μl of crRNA1 (SEQ ID ON.4, 100 μM), 0.33 μl of crRNA2 (100 μM), 0.33 μl of crRNA3 (SEQ ID ON.5, 100 μM) and 1 μl of Alt-R.CRISPR - Cas9tracrRNA (SEQ ID ON.6, 100 μM) was thoroughly mixed and then diluted to a concentration of 20-80 μM with a nuclease-free buffer to obtain an RNA mixture. The RNA mixture was heated at 95°C for 5 min and cooled at room temperature for 10 min to obtain an annealed RNA mixture. Take 2.9 μl of the annealed RNA mixture and 1 μl of Cas 9 protein according to the ratio of 1.2:1-2:1, mix thoroughly and leave at room temperature for 10 minutes. After adding 0.6 μl electroporation enhancement solution, react at room temperature for 5 minutes to obtain RNP complex.

[0102] ② Electrotransfer of the RNP complex into the SH-SY5Y cells to be kn...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a target protein for promoting neuron regeneration and application of the target protein. The invention discloses application of a substance for inhibiting LRP1 gene expression in preparation of drugs for treating neurodegenerative diseases and / or Alzheimer's disease. According to the invention, ADAM10 is successfully knocked out from SH-SY5Y cells in the earlier stage, so that a cell model capable of more comprehensively reflecting AD is constructed. The LRP1 gene is knocked out in the AD cell model, and after the LRP1 protein is knocked down, A beta 42 and inflammasome NLRP3 protein is remarkably reduced, the cell neuronal differentiation capacity is enhanced, the neuronal length is remarkably increased, and meanwhile information exchange between cells is remarkably increased. It is shown that the LRP1 protein may be a novel target in neurodegenerative diseases and / or AD, and the drug which is synthesized for the target and inhibits expression of the target gene can treat the neurodegenerative diseases and / or AD more comprehensively.

Description

technical field [0001] The invention belongs to the field of biomedicine and relates to a target protein for promoting neuron regeneration and its application. Background technique [0002] Studies have shown that LRP1 protein can regulate the uptake and diffusion of Tau protein. Tau protein is one of the most popular hypotheses in Alzheimer's disease research, but it cannot predict whether LRP1 can promote the regeneration of neurons, and The function of LRP1 gene on neuron regeneration in AD has not yet been elucidated. At present, the most intuitive symptom of most neurodegenerative diseases is the impairment of neuron function. Can LRP1 be used as a key target for neuron regeneration? Contents of the invention [0003] The object of the present invention is to address the above-mentioned deficiencies in the prior art, and to provide the application of substances inhibiting LRP1 gene expression in the preparation of drugs for treating neurodegenerative diseases or Alzh...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K45/00A61K48/00A61K31/7088A61P25/00A61P25/28C12N9/22C12N15/113G01N33/68
CPCA61K45/00A61K48/005A61K31/7088A61P25/00A61P25/28C12N9/22C12N15/1138G01N33/6893C12N2310/20G01N2333/705G01N2800/2821
Inventor 王广基李昔诺阿基业朱哲英徐进宜孙渊
Owner CHINA PHARM UNIV