Supercharge Your Innovation With Domain-Expert AI Agents!

Industrial hemp sex linkage SNP molecular marker, screening method and application thereof

An industrial hemp, molecular marker technology, applied in biochemical equipment and methods, recombinant DNA technology, DNA/RNA fragments, etc., can solve the problems of low SNP molecular marker accuracy and unsatisfactory identification results, and achieve efficient identification and accurate identification. The effect of high degree and high degree of discrimination

Active Publication Date: 2021-07-23
山东玄康种业科技有限公司
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In view of the technical problems of existing SNP molecular markers such as low accuracy and unsatisfactory identification results, the present invention proposes a high-accuracy, high-sex discrimination Sex-linked SNP molecular markers, screening methods and applications of industrial hemp

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Industrial hemp sex linkage SNP molecular marker, screening method and application thereof
  • Industrial hemp sex linkage SNP molecular marker, screening method and application thereof
  • Industrial hemp sex linkage SNP molecular marker, screening method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0089] This embodiment provides a screening method for sex-linked SNP molecular markers in industrial hemp. The screening method uses the MADC6 fragment as a male-specific sequence fragment, and specifically includes the following steps:

[0090] (1) With the MADC6 fragment as the male-specific sequence fragment, its nucleotide sequence is shown in SEQ ID NO.1, and the MADC6 fragment is compared with the cannabis genome database (http: / / genome.ccbr.utoronto.ca / ) Sequences are compared, and the results of the comparison of the two are as follows figure 1 As shown, the sequence with the highest similarity to the MADC6 fragment was obtained, which was recorded as sequence A;

[0091] (2) Design six specific primers and six random degenerate primers using the MADC6 fragment as a template, and design the chromosome walking primers for the MADC6 fragment as follows: figure 2 As shown, wherein, the six specific primers are six forward and reverse specific primers, respectively SP1F a...

Embodiment 2

[0113] This embodiment provides a verification experiment for the accuracy of sex-linked SNP molecular markers in industrial hemp, specifically:

[0114] (1) Using the flanking sequence WBSDMY604 amplified in Example 1 as a template to design three flanking sequence primers, respectively F1, F2 and R, the primer sequences are shown in Table 4:

[0115] Table 4 Three flanking sequence primer sequences

[0116] Primer name Primer sequence (5'-3') F1 GAAGGTGACCAAGTTCATGCTAGCACCTCCTCCTTCGAG F2 GAAGGTCGGAGTCAACGGATTAGCACCTCCTCCTTCGAT R GAATTTTATGCTGATTTTTGTGTTGTGAA

[0117] (2) Select industrial hemp varieties HYJL-18 and HYR-3 as verification samples, select 24 samples for each variety, extract sample DNA according to the CTAB method as a template, and use primers F1, F2 and R as primers for KASP reaction. The system and reaction procedure are:

[0118] Table 5 KASP reaction system

[0119] PCR components Volume (μl) Matrix Mix...

Embodiment 3

[0128] This embodiment provides a verification experiment for the accuracy of sex-linked SNP molecular markers in industrial hemp, specifically:

[0129] (1) In this embodiment, industrial hemp varieties HYW-23, HYT-14G, HYLS-19 and HYM-5 are selected as verification samples as templates, and the three flanking sequence primers F1, F2 and R shown in Example 2 are used as primers KASP reaction, the specific reaction system and reaction procedure are the same as in Example 2, to obtain the KASP labeled detection sample;

[0130] (2) Perform fluorescence scanning on the KASP marker detection sample obtained in step (1) and analyze it on the SNPWAY platform, and compare the SNP typing results with the actual cannabis sex. The SNP molecular marker typing results are as follows: Figure 7 Shown, to evaluate the accuracy of the SNP molecular marker;

[0131] (3) On this basis, this embodiment also performs MADC6 labeling detection on the above-mentioned KASP product, and the detecti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an industrial hemp sex linkage SNP molecular marker, a screening method and application thereof, belongs to the technical field of molecular markers, and can solve the problems that an existing SNP molecular marker is low in accuracy and unsatisfactory in identification result. According to the technical scheme, the screening method comprises the following steps of comparing a male specific sequence fragment with a sequence in a hemp genome database to obtain the comparison difference of X chromosome and Y chromosome fragments of industrial hemp; designing a plurality of pairs of specific primers and a plurality of pairs of random degenerate primers by taking a male specific sequence fragment as a template according to the comparison difference of X chromosome and Y chromosome fragments of industrial hemp, and carrying out multiple rounds of PCR amplification reaction by taking the specific primers and the random degenerate primers as primers; carrying out sequencing analysis on PCR products obtained by the multiple rounds of PCR amplification reactions, and screening out flanking sequences of male specific sequence fragments; comparing the flanking sequences with a sequence in the hemp genome database, and determining an SNP molecular marker site according to a comparison result. The method has the characteristics of high accuracy, high sex discrimination degree and the like.

Description

technical field [0001] The invention belongs to the technical field of molecular markers, in particular to a sex-linked SNP molecular marker of industrial hemp, a screening method and an application thereof. Background technique [0002] Cannabis is an annual erect herbaceous plant belonging to the genus Cannabis of the family Moraceae of the order Urtica. According to the level of cannabinoids, hemp is divided into drug hemp and industrial hemp. Among them, industrial hemp is widely used, such as textile, paper, medicine, hygiene, daily chemical, leather, automobile, construction, decoration and other fields. [0003] Marijuana contains cannabinoids, also known as cannabinoids, which have a wide range of medicinal values. They have been discovered and used to treat anxiety, depression, mood disorders, chronic pain, arthritis, cancer, Parkinson's and other diseases. Cannabinoids mainly exist in the flowers and leaves of female plants, and the content of cannabinoids will de...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12Q1/6879C12Q1/6809C12N15/113
CPCC12Q1/6895C12Q1/6879C12Q1/6809C12Q2600/156C12Q2531/113C12Q2565/125
Inventor 张从省王喜萍
Owner 山东玄康种业科技有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More