Sex-linked SNP molecular markers, screening methods and applications of industrial hemp
An industrial hemp, molecular marker technology, applied in biochemical equipment and methods, recombinant DNA technology, DNA/RNA fragments, etc., to achieve high accuracy, high discrimination, and good stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0089] This embodiment provides a screening method for sex-linked SNP molecular markers in industrial hemp. The screening method uses the MADC6 fragment as a male-specific sequence fragment, and specifically includes the following steps:
[0090] (1) With the MADC6 fragment as the male-specific sequence fragment, its nucleotide sequence is shown in SEQ ID NO.1, and the MADC6 fragment is compared with the cannabis genome database (http: / / genome.ccbr.utoronto.ca / ) Sequences were compared, and the results of the comparison of the two were as follows figure 1 As shown, the sequence with the highest similarity to the MADC6 fragment was obtained, which was recorded as sequence A;
[0091] (2) Design six specific primers and six random degenerate primers using the MADC6 fragment as a template, and design the chromosome walking primers for the MADC6 fragment as follows: figure 2 As shown, wherein, the six specific primers are six forward and reverse specific primers, respectively SP1F...
Embodiment 2
[0113] This embodiment provides a verification experiment for the accuracy of sex-linked SNP molecular markers in industrial hemp, specifically:
[0114] (1) Using the flanking sequence WBSDMY604 amplified in Example 1 as a template to design three flanking sequence primers, respectively F1, F2 and R, the primer sequences are shown in Table 4:
[0115] Table 4 Three flanking sequence primer sequences
[0116] Primer name Primer sequence (5'-3') F1 GAAGGTGACCAAGTTCATGCTAGCACCTCCTCCTTCGAG F2 GAAGGTCGGAGTCAACGGATTAGCACCTCCTCCTTCGAT R GAATTTTATGCTGATTTTTGTGTTGTGAA
[0117] (2) Select industrial hemp varieties HYJL-18 and HYR-3 as verification samples, select 24 samples for each variety, extract sample DNA according to the CTAB method as a template, and use primers F1, F2 and R as primers for KASP reaction. The system and reaction procedure are:
[0118] Table 5 KASP reaction system
[0119] PCR components Volume (μl) Matrix Mix...
Embodiment 3
[0128] This embodiment provides a verification experiment for the accuracy of sex-linked SNP molecular markers in industrial hemp, specifically:
[0129] (1) In this embodiment, industrial hemp varieties HYW-23, HYT-14G, HYLS-19 and HYM-5 are selected as verification samples as templates, and the three flanking sequence primers F1, F2 and R shown in Example 2 are used as primers KASP reaction, the specific reaction system and reaction procedure are the same as in Example 2, to obtain the KASP labeled detection sample;
[0130] (2) Perform fluorescence scanning on the KASP marker detection sample obtained in step (1) and analyze it on the SNPWAY platform, and compare the SNP typing results with the actual cannabis sex. The SNP molecular marker typing results are as follows: Figure 7 Shown, to evaluate the accuracy of the SNP molecular marker;
[0131] (3) On this basis, this embodiment also performs MADC6 labeling detection on the above-mentioned KASP product, and the detecti...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com