SNP molecular marker for identifying mycobacterium tuberculosis complex, PCR primer and application

A technology for Mycobacterium tuberculosis and molecular markers, which is applied in the field of SNP molecular markers for identifying Mycobacterium tuberculosis complexes, and can solve problems such as inability to distinguish strains

Active Publication Date: 2021-09-10
BEIJING CHEST HOSPITAL CAPITAL MEDICAL UNIV +1
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the high consistency and close kinship of some mycobacterial homologous DNA sequences, the 16S rDNA sequence composition is completely consistent, so it is impossible to distinguish some strains with close kinship, such as Mycobacterium avium and Mycobacterium intracellulare, turtle clam Mycobacterium and Mycobacterium abscessus, Mycobacterium kansasii and Stomach, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SNP molecular marker for identifying mycobacterium tuberculosis complex, PCR primer and application
  • SNP molecular marker for identifying mycobacterium tuberculosis complex, PCR primer and application
  • SNP molecular marker for identifying mycobacterium tuberculosis complex, PCR primer and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Embodiment 1: SNP molecular marker

[0062] The SNP molecular marker selected in the present invention is located on the Hsp65 gene and the rpsA gene. The selected gene is highly conserved within the Mycobacterium genus, and has strong diversity among different NTMs. The specific method is to divide the target gene into 10 longer fragments through the online analysis software MEME, and follow the internal differences of MTBC as much as possible. Based on the principle that the difference between MTBC and NTM is as large as possible, the internal fragment of the gene was selected as the candidate amplification region. Import the selected fragments into the MEGA7.0 software for gene alignment, and mark the variable sites, which are SNPs, following the principle that the SNP diversity at the same site is as strong as possible (with two or more base types ), filter for backup. According to the construction of the evolutionary tree of the target gene, it can be seen that t...

Embodiment 2

[0083] Embodiment 2: PCR detects the kind of mycobacteria to be detected

[0084] Detection method:

[0085] 1) extract the genomic DNA of the sample to be tested;

[0086] 2) Using the extracted genomic DNA as a template, using the primers shown in SEQ ID No.3-4 and the primers shown in SEQ ID No.5-6 respectively, amplify the DNA fragments containing the core SNP markers by PCR reaction;

[0087] 3) Detecting the PCR amplification product, performing sequencing on the amplification product, analyzing the sequencing result, and interpreting the polymorphism at the SNP site.

[0088] Table 2. PCR primer pairs

[0089]

[0090] SEQ ID No. 1:

[0091] GTGATCAGCGAAGAGGTCGGCCTGACGCTGGAGAACGCCGACCTGTCGCTGCTAGGCAAGGCCCGCAAGGTCGTGGTCACCAAGGACGAGACCACCATCGTCGAGGGCGCCGGTGACACCGACGCCATCGCCGGACGAGTGGCCCAGATCCGCCAGGAGATCGAGAACAGCGACTCCGACTACGACCGTGAGAAGCTGCAGGAGCGGCTGGCCAAGCTGGCCGGTGGTGTCGCGGTGATCAAGGCCGGTGCCGCCACCGAGGTCGAACTCAAGGAGCG;

[0092] SEQ ID No.2:

[0093]ATCCGAAAGGGTGTCG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an SNP molecular marker for identifying a mycobacterium tuberculosis complex, a PCR primer and application, and relates to the technical field of molecular markers and application thereof. The SNP molecular marker comprises SNP 1 to SNP 8 which are positioned on an Hsp65 gene and SNP 9 to SNP 15 which are positioned on an rpsA gene. The SNP molecular marker has polymorphism in 10 types of mycobacteria, and the types of the mycobacteria to be detected can be identified by detecting the basic group types of the mycobacteria on the SNP sites.

Description

technical field [0001] The invention relates to the technical field of molecular markers, in particular to a SNP molecular marker for identifying mycobacterium tuberculosis complex, PCR primers and applications. Background technique [0002] Tuberculosis (TB), caused by Mycobacterium tuberculosis complex, is the single infectious disease with the highest fatality rate. According to the 2020 WHO report, there are 2 billion TB infections, accounting for 1 / 3-1 / 4 of the global total, while the number of cases is about 10 million and the death toll is 1.4 million. Correspondingly, there are about 350 million people infected with TB in my country, with 866,000 cases and 39,000 deaths, ranking third in the world. [0003] Mycobacterium tuberculosis complex belongs to the genus Mycobacterium, mainly including Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium africanum, Mycobacterium microti and Mycobacterium Kennedy, etc. Several species. In the Mycobacterium genus, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/689C12Q1/6858C12Q1/04C12N15/11
CPCC12Q1/689C12Q1/6858C12Q2600/156C12Q2531/113
Inventor朱晨迪贾俊楠李卫民
OwnerBEIJING CHEST HOSPITAL CAPITAL MEDICAL UNIV