SNP molecular marker for identifying mycobacterium tuberculosis complex, PCR primer and application
A technology for Mycobacterium tuberculosis and molecular markers, which is applied in the field of SNP molecular markers for identifying Mycobacterium tuberculosis complexes, and can solve problems such as inability to distinguish strains
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0061] Embodiment 1: SNP molecular marker
[0062] The SNP molecular marker selected in the present invention is located on the Hsp65 gene and the rpsA gene. The selected gene is highly conserved within the Mycobacterium genus, and has strong diversity among different NTMs. The specific method is to divide the target gene into 10 longer fragments through the online analysis software MEME, and follow the internal differences of MTBC as much as possible. Based on the principle that the difference between MTBC and NTM is as large as possible, the internal fragment of the gene was selected as the candidate amplification region. Import the selected fragments into the MEGA7.0 software for gene alignment, and mark the variable sites, which are SNPs, following the principle that the SNP diversity at the same site is as strong as possible (with two or more base types ), filter for backup. According to the construction of the evolutionary tree of the target gene, it can be seen that t...
Embodiment 2
[0083] Embodiment 2: PCR detects the kind of mycobacteria to be detected
[0084] Detection method:
[0085] 1) extract the genomic DNA of the sample to be tested;
[0086] 2) Using the extracted genomic DNA as a template, using the primers shown in SEQ ID No.3-4 and the primers shown in SEQ ID No.5-6 respectively, amplify the DNA fragments containing the core SNP markers by PCR reaction;
[0087] 3) Detecting the PCR amplification product, performing sequencing on the amplification product, analyzing the sequencing result, and interpreting the polymorphism at the SNP site.
[0088] Table 2. PCR primer pairs
[0089]
[0090] SEQ ID No. 1:
[0091] GTGATCAGCGAAGAGGTCGGCCTGACGCTGGAGAACGCCGACCTGTCGCTGCTAGGCAAGGCCCGCAAGGTCGTGGTCACCAAGGACGAGACCACCATCGTCGAGGGCGCCGGTGACACCGACGCCATCGCCGGACGAGTGGCCCAGATCCGCCAGGAGATCGAGAACAGCGACTCCGACTACGACCGTGAGAAGCTGCAGGAGCGGCTGGCCAAGCTGGCCGGTGGTGTCGCGGTGATCAAGGCCGGTGCCGCCACCGAGGTCGAACTCAAGGAGCG;
[0092] SEQ ID No.2:
[0093]ATCCGAAAGGGTGTCG...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


